lineamientos para la vigilancia epidemiológica de dengue - gob.mx

Loading...

Dirección General de Epidemiología

lineamientos para la vigilancia epidemiológica de dengue por laboratorio

Instituto de Diagnóstico y referencia Epidemiológicos “Dr. Manuel Martínez Báez”

LINEAMIENTOS PARA LA VIGILANCIA EPIDEMIOLÓGICA DE DENGUE POR LABORATORIO

DGE-InDRE–RNLSP 2015

Fotografía de la portada es propiedad de HKS Arquitectos

1

PRIMERA EDICIÓN, 2015 DENGUE–RNLSP ESTE DOCUMENTO ESTÁ AVALADO POR LOS REPRESENTANTES DE LAS INSTITUCIONES QUE CONFORMAN EL GRUPO TÉCNICO INTERINSTITUCIONAL DEL COMITÉ NACIONAL PARA LA VIGILANCIA EPIDEMIOLÓGICA (CONAVE). TODOS LOS DERECHOS RESERVADOS CONFORME A LA LEY © INDRE-SECRETARÍA DE SALUD SE PERMITE LA REPRODUCCIÓN TOTAL O PARCIAL SI SE CITA LA FUENTE: “LINEAMIENTOS PARA LA VIGILANCIA EPIDEMIOLÓGICA DE DENGUE POR LABORATORIO” VERSIÓN NO. 01. INDRE, 2015. COLECCIÓN PUBLICACIONES TÉCNICAS DEL INDRE ISBN: EN PROCESO INSTITUTO DE DIAGNÓSTICO Y REFERENCIA EPIDEMIOLÓGICOS DR. MANUEL MARTÍNEZ BÁEZ FRANCISCO P MIRANDA 177, COL. LOMAS DE PLATEROS DEL. ÁLVARO OBREGÓN, C. P. 01480, MÉXICO, D. F. WWW.INDRE.SALUD.GOB.MX TEL. (55)53-42-75-50 LA EDICIÓN ESTUVO A CARGO DE: DR. JOSÉ ALBERTO DÍAZ QUIÑONEZ

EL DISEÑO ESTUVO A CARGO DE: LIC. BRENDA ESCOBEDO LÓPEZ

IMPRESO EN MÉXICO. PRINTED IN MEXICO

2

SECRETARÍA DE SALUD DRA. MERCEDES JUAN LÓPEZ SECRETARIA DE SALUD DR. EDUARDO GONZÁLEZ PIER SUBSECRETARIO DE INTEGRACIÓN Y DESARROLLO DEL SECTOR SALUD DR. PABLO ANTONIO KURI MORALES SUBSECRETARIO DE PREVENCIÓN Y PROMOCIÓN DE LA SALUD LIC. MARCELA GUILLERMINA VELASCO GONZÁLEZ SUBSECRETARIA DE ADMINISTRACIÓN Y FINANZAS DR. GABRIEL O´SHEA CUEVAS COMISIONADO NACIONAL DE PROTECCIÓN SOCIAL EN SALUD LIC. MIKEL ARRIOLA PEÑALOZA COMISIONADO FEDERAL DE PROTECCIÓN CONTRA RIESGOS SANITARIOS DR. JOSÉ MELJEM MOCTEZUMA COMISIONADO NACIONAL DE ARBITRAJE MÉDICO DR. GUILLERMO MIGUEL RUIZ-PALACIOS Y SANTOS TITULAR DE LA COMISIÓN COORDINADORA DE INSTITUTOS NACIONALES DE SALUD Y HOSPITALES DE ALTA ESPECIALIDAD LIC. RODRIGO REINA LICEAGA TITULAR DE LA UNIDAD COORDINADORA DE VINCULACIÓN Y PARTICIPACIÓN SOCIAL DR. NELLY AGUILERA ABURTO TITULAR DE LA UNIDAD DE ANÁLISIS ECONÓMICO LIC. CARLOS SANDOVAL LEYVA DIRECTOR GENERAL DE COMUNICACIÓN SOCIAL DR. JESÚS FELIPE GONZÁLEZ ROLDAN DIRECTOR GENERAL DEL CENTRO NACIONAL DE PROGRAMAS PREVENTIVOS Y CONTROL DE ENFERMEDADES DR. EDUARDO JARAMILLO NAVARRETE DIRECTOR GENERAL DE PROMOCIÓN DE LA SALUD DR. CUITLÁHUAC RUIZ MATUS DIRECTOR GENERAL DE EPIDEMIOLOGÍA

3

LIC. JUAN CARLOS REYES OROPEZA DIRECTOR GENERAL DE INFORMACIÓN EN SALUD

4

INSTITUTO DE DIAGNÓSTICO Y REFERENCIA EPIDEMIOLÓGICOS DR. MANUEL MARTÍNEZ BÁEZ DR. JOSÉ ALBERTO DÍAZ QUIÑONEZ DIRECTOR GENERAL ADJUNTO BIOL. IRMA LÓPEZ MARTÍNEZ DIRECTORA DE DIAGNÓSTICO Y REFERENCIA QFB. LUCÍA HERNÁNDEZ RIVAS DIRECTORA DE SERVICIOS Y APOYO TÉCNICO LIC. ADRIANA CASTRO CABRERA SUBDIRECTORA DE OPERACIÓN BIOL. NORMA ANGÉLICA MONTES COLIMA JEFA DEL DEPARTAMENTO DE BACTERIOLOGÍA QBP. IRMA HERNÁNDEZ MONROY ASESORA TÉCNICA DE LA DIRECCIÓN M. EN C. BELÉN TORRES LONGORIA JEFA DEL DEPARTAMENTO DE VIROLOGÍA QFB. ROBERTO VÁZQUEZ CAMPUZANO JEFE DEL DEPARTAMENTO DE ENFERMEDADES EMERGENTES Y URGENCIAS M. EN C. JUAN CARLOS CARPIO PEDROZA JEFE DEL DEPARTAMENTO DE PARASITOLOGÍA DRA. CLARA GORODEZKY LAUFERMAN JEFA DEL DEPARTAMENTO DE INMUNOLOGÍA M. EN C. JUDITH ESTEVEZ RAMÍREZ JEFA DEL DEPARTAMENTO DE CONTROL DE MUESTRAS Y SERVICIOS DR. JOSÉ ERNESTO RAMÍREZ GONZÁLEZ JEFE DEL DEPARTAMENTO DE BIOLOGÍA MOLECULAR Y VALIDACIÓN DE TÉCNICAS M. EN C. MAURICIO VÁZQUEZ PICHARDO COORDINADOR DE ENFERMEDADES VIRALES ZOONÓTICAS Y POR VECTOR

5

GRUPO DE TRABAJO M. EN C. MAURICIO VÁZQUEZ PICHARDO COORDINADOR DE ENFERMEDADES VIRALES ZOONÓTICAS Y POR VECTOR QFB. CLAUDIA ROSALES JIMÉNEZ ADSCRITA AL LABORATORIO DE ARBOVIRUS Y VIRUS HEMORRÁGICOS BIOL. IRMA LÓPEZ MARTÍNEZ DIRECTORA DE DIAGNÓSTICO Y REFERENCIA DR. HUGO MARTÍNEZ ROJANO ASESOR TÉCNICO DE LA DIRECCIÓN GENERAL ADJUNTA DEL INDRE COORDINADOR DE MEDICINA LABORAL DR. JOSÉ ALBERTO DÍAZ QUIÑONEZ DIRECTOR GENERAL ADJUNTO

6

LINEAMIENTOS PARA LA VIGILANCIA EPIDEMIOLÓGICA DE DENGUE POR LABORATORIO

DGE-InDRE–RNLSP 2015

7

ÍNDICE INTRODUCCIÓN 9 ANTECEDENTES DE LA RNLSP PARA EL DIAGNÓSTICO DE DENGUE 10 MARCO LEGAL 12 DEFINICIONES OPERATIVAS 12 OBJETIVO GENERAL 14 Objetivos específicos 14 RED NACIONAL DE LABORATORIOS PARA LA VIGILANCIA DE DENGUE 15 Organización de la Red Nacional de Laboratorios para el Diagnóstico de Dengue15 Funciones de los integrantes de la Red Nacional de Laboratorios para el Diagnóstico de Dengue 16 Funciones del laboratorio nacional de referencia 16 Funciones de los laboratorios estatales de salud pública 17 DIAGNÓSTICO DE DENGUE POR LABORATORIO 18 Toma, manejo y envío de muestras clínicas 18 Algoritmo de laboratorio para el diagnóstico de dengue 20 ESTÁNDAR DE CALIDAD 29 Captura de datos y resultados 31 PROGRAMA DE EVALUACIÓN EXTERNA DEL DESEMPEÑO (PEED) 34 Criterios para la liberación del diagnóstico 39 Banco de material biológico 40 Indicaciones para la detección e identificación de serotipos de virus dengue mediante RT-PCR Multiplex en tiempo real 40 1) Laboratorios estatales que aún no realizan RT-PCR Multiplex en tiempo real para detección e identificación de serotipos de virus dengue 41 2) Laboratorios estatales que realizan RT-PCR Multiplex en tiempo real para detección e identificación de serotipos de virus dengue 41 CRONOGRAMA DE ACTIVIDADES 43 BIBLIOGRAFÍA 45 ANEXOS 47 I. TÉCNICAS DIAGNÓSTICAS Y PREPARACIÓN DE REACTIVOS 48 Biología molecular 66 II. CARACTERÍSTICAS DE LOS ESTUCHES COMERCIALES 82 III. FORMATO PARA ENVÍO DE MATERIAL BIOLÓGICO AL InDRE 84

8

INTRODUCCIÓN A nivel mundial las enfermedades virales transmitidas por vector están consideradas como las de mayor repercusión en Salud Pública. Actualmente la Organización Mundial de la Salud (OMS) cataloga a las arbovirosis como problema prioritario en salud y en 1998 fueron consideradas como la décima causa de muerte por enfermedades infecciosas en el mundo. Existen cuatro serotipos del dengue (DEN1, DEN2, DEN3, DEN4), la OMS estima que estos constituyen una amenaza para el 40% de la población mundial que habita en 112 países tropicales y subtropicales. Se considera que en la actualidad existen 50 millones de casos en todo el mundo, de los que aproximadamente 400,000 son casos graves y 25,000 fallecen a causa de esta enfermedad. En el Continente Americano el dengue tuvo un surgimiento importante en los servicios de salud desde 1989, ya que el número de casos aumentó un 60% en comparación con el lustro anterior. En México es la principal enfermedad viral transmitida por vector. El dengue es una enfermedad febril, transmitida por el mosco hembra hematófaga del género Aedes aegypti, la enfermedad es de curso auto-limitado, incapacitante y con riesgo de complicaciones letales, la cual se puede presentar de manera benigna conocida como Fiebre por Dengue (FD) y de manera grave conocida como Fiebre Hemorrágica por Dengue (FHD). El presente documento establece los lineamientos de operación para la vigilancia epidemiológica de dengue basada en laboratorio y la implementación del nuevo algoritmo de laboratorio para el diagnóstico de dengue; la descripción de los lineamientos incluye funciones y responsabilidades por nivel, toma, manejo y envío de muestras, así como las metodologías para el análisis de muestras, evaluación del desempeño, banco de muestras y los estándares de calidad.

Red Nacional de Laboratorios de Salud Pública La Red Nacional de Laboratorios de Salud Pública (RNLSP) es el conjunto de laboratorios para la vigilancia epidemiológica con objetivos específicos que le han permitido unificar métodos de diagnóstico, criterios de interpretación de resultados, transferencia tecnológica, generación de conocimiento y formación de recursos humanos. Es el soporte técnico-científico útil para la vigilancia epidemiológica y que genera información de calidad para la toma oportuna de decisiones a través de la confirmación de diagnósticos mediante estudios de laboratorio en muestras biológicas. La RNLSP depende de la Secretaría de Salud y es el Instituto de Diagnóstico y Referencia Epidemiológicos (InDRE) su órgano rector en el área de vigilancia epidemiológica. Tiene fundamento legal en la Norma Oficial Mexicana NOM-017SSA2-2012, Para la vigilancia epidemiológica y está conformada por 31 9

Laboratorios Estatales de Salud Pública (LESP) de las 32 entidades federativas del país (el Distrito Federal envía sus muestras al InDRE). El Marco Analítico Básico de la RNLSP consta de 27 diagnósticos, distribuidos en 16 redes de vigilancia específica.

ANTECEDENTES DE LA RNLSP PARA EL DIAGNÓSTICO DE DENGUE En 1995 en México se conformó la Red para el Diagnóstico de Dengue, integrada por siete Laboratorios Estatales de Salud Pública (LESP). A partir de ese año el Laboratorio de Arbovirus y Virus Hemorrágicos del Instituto de Diagnóstico y Referencia Epidemiológicos (InDRE), instancia del ejecutivo federal que entre otras funciones, desarrolla y promueve acciones de aseguramiento de la calidad, para promover la mejora continua en el desempeño técnico, ha ofrecido a la Red cursos de capacitación, capacitaciones en servicio, supervisiones y asesorías, incluyendo el apoyo con equipo e insumos en caso de emergencias epidemiológicas y desastres. Actualmente apoya a los LESP con el envío de reactivos e insumos para realizar la determinación de anticuerpos IgM, anticuerpos IgG y para la detección de antígeno viral NS1 comerciales. Desde 1999 el Laboratorio de Arbovirus inició un programa de control de calidad en el que la Red enviaba al InDRE el 100% de las muestras positivas y 10% de las muestras negativas para dengue. En el 2002 la Red Nacional de Laboratorios de Salud Pública (RNLSP) se incorporó al Programa Caminando a la Excelencia para evaluar el desempeño de los LESP. La evaluación del desempeño es una parte importante del sistema de calidad y tiene como objetivo promover la calidad analítica entre los laboratorios, ayudando a identificar errores y estimulando el mejor desempeño de los mismos, respecto a los programas prioritarios de la salud para fomentar su desarrollo. En el año 2003 se inició la evaluación del desempeño para el diagnóstico serológico de dengue mediante el envío de paneles de eficiencia y se estableció el envío únicamente de muestras probables de Fiebre Hemorrágica por Dengue o Dengue Grave para control de calidad o en su caso muestras con serotipo no identificado en los últimos años en el estado. En julio de 2012 esta evaluación del desempeño se actualizó y mejoró, al implementar paneles algorítmicos que evalúan de manera integral el desempeño de cada LESP con respecto al algoritmo de diagnóstico vigente y a partir de 2013 fueron incluidos los paneles algorítmicos únicos “SMART-ONLY-DEN”. Durante abril del 2008 el Laboratorio de Arbovirus implementó un nuevo algoritmo de diagnóstico que incluía la detección de antígeno NS1 (glicoproteína no estructural 1 del virus dengue) en formato de Ensayo por Inmunoabsorción Ligado a Enzimas (ELISA); metodología que es aplicable únicamente en muestras obtenidas durante la fase aguda de la enfermedad y que tiene el objetivo de brindar resultados oportunos y confiables. Los resultados positivos de esta metodología 10

han sido aprovechados para realizar la vigilancia virológica (tipificación del virus) en un porcentaje de muestras mediante la Prueba de Retro-transcripción y de la Reacción en Cadena de la Polimerasa (RT-PCR) en tiempo real. En marzo de 2010, el Laboratorio de Arbovirus y Virus Hemorrágicos del InDRE capacitó al personal de 28 laboratorios estatales que conformaban la RNLSP para dar a conocer el protocolo “Detección y Serotipificación de Virus Dengue Mediante RT-PCR Multiplex en tiempo real” validado por el Centro de Control y Prevención de Enfermedades, División Dengue CDC-Dengue Branch de San Juan Puerto Rico, con la finalidad de que cada LESP realizara la vigilancia virológica en su estado. El seguimiento a la implementación de esta metodología se realizó mediante la aplicación de una cédula. Durante el 2011 fueron 15 los LESP que iniciaron la etapa de control de calidad para RT-PCR en tiempo real para dengue: Baja California Sur, Chiapas, Guerrero, Morelos, Nuevo León, Oaxaca, Querétaro, Quintana Roo, San Luis Potosí, Tabasco, Chihuahua, Sonora, Jalisco, Veracruz y Yucatán. A partir de 2012 se incorporaron seis LESP a la Red Nacional de Laboratorios para el Diagnóstico de Dengue (Michoacán, Campeche, Sonora, Sinaloa, Zacatecas y Guanajuato), contando hasta ahora con 21 LESP. Actualmente, los estados antes mencionados cuentan con la metodología liberada debido a que cumplieron con los parámetros de concordancia requeridos por el Laboratorio de Arbovirus y Virus Hemorrágicos (promedio de 95% de concordancia en fase de control de calidad y en paneles de evaluación externa del desempeño). Los LESP de Nayarit y Colima se encuentran en fase de control de calidad con resultados de más del 99.5% de concordancia, motivo por el cual en los meses siguientes recibirán la notificación de liberación de la metodología. El LESP de Hidalgo comenzó en este año la fase de control de calidad, obteniendo un resultado del 100% de concordancia en el panel “SMART-ONLY-DEN” 2013-01. Así mismo el LESP de Chihuahua ya cuenta con la implementación de la metodología, pero por ser un estado no endémico y no tener muestras positivas al antígeno NS1, la liberación de la misma estuvo basada en la aplicación de un panel para la evaluación externa del desempeño, en el que obtuvo un resultado sobresaliente (90-100% de concordancia); este mismo lineamiento aplicará para aquellos LESP que estén en la misma situación, como el LESP de Durango, el cual obtuvo 100% de concordancia en el panel “SMART-ONLY-DEN” 2013-01. En caso de que el porcentaje de concordancia del panel no cumpla con los requerimientos, la metodología no será liberada. Esto último permitirá que dichos estados tengan habilitados los métodos analíticos y las herramientas para poder utilizarlos ante cualquier contingencia, al presentarse casos positivos de NS1. Todos los LESP que cuentan con la técnica diagnóstica molecular liberada son capaces de realizar la vigilancia intencionada directamente en mosquitos trasmisores del virus (vigilancia entomo-virológica). Esta última deberá ser realizada en completa coordinación con el InDRE (Laboratorio de Arbovirus y Virus Hemorrágicos y el Laboratorio de Entomología) y el Programa de Control de Vectores Nacional y Estatal.

11

MARCO LEGAL 1. Constitución Política de los Estados Unidos Mexicanos. Artículo 4. DOF 05/02/1917, Última Reforma D.O.F. 15/02/2012. 2. Ley General de Salud. Artículo 3, XV; 59; 64, III; 133; 134, I; 136, 138, 139 y 141. DOF 7/02/1984, Última Reforma DOF 07/06/2012. 3. Norma Oficial Mexicana NOM-017-SSA2-2012, Para la vigilancia epidemiológica. DOF: 19/02/2013. 4. Norma Oficial Mexicana NOM-087-ECOL-SSA1-2002. Protección ambientalsalud ambiental-residuos peligrosos biológico-infecciosos-clasificación y especificaciones de manejo. 5. Norma Oficial Mexicana NOM-052-SEMARNAT-2005, Que establece las características, el procedimiento de identificación, clasificación y los listados de los residuos peligrosos. DOF: 23/06/2006. 6. Norma Oficial Mexicana NOM-032-SSA2-2010 para la Vigilancia Epidemiología, Prevención y Control de Enfermedades Transmitidas por Vector. 7. Lineamientos para programas de evaluación externa del desempeño de la Red Nacional de Laboratorios de Salud Pública, InDRE-Secretaría de Salud, 2013 8. Criterios de Operación para la Red Nacional de Laboratorios de Salud Pública, DGE-InDRE-RNLSP, Secretaría de Salud, 2013. 9. Secretaría de Salud. Programa Sectorial de Salud 2013-2018. Diario Oficial de la Federación DOF: 12/12/2013. 10. Plan Nacional de Desarrollo 2013-2018. Diario Oficial de la Federación, DOF: 20/05/2013, www.dof.gob.mx 11. Secretaría de Salud. Programa de Acción Específico 2013-2018. Sistema Nacional de Vigilancia Epidemiológica, primera edición 2014.

DEFINICIONES OPERATIVAS Para los propósitos de la vigilancia epidemiológica se han elaborado definiciones operacionales de caso, a efecto de unificar los criterios para la detección, notificación y clasificación de los casos de dengue. La especificidad del diagnóstico está proporcionada por los estudios de laboratorio, por lo que es importante contar con los resultados virológicos, serológicos y de gabinete para el adecuado seguimiento del caso hasta su clasificación final. Según los lineamientos para la Vigilancia Epidemiológica de Fiebre por Dengue y Fiebre Hemorrágica por Dengue, las definiciones operativas son las siguientes: Vigilancia epidemiológica: Es el estudio permanente y dinámico del estado de salud en la población y tiene como propósito presentar opciones para la toma de decisiones. Desde el punto de vista operativo incluye la recopilación, el procesamiento y el análisis de los daños y riesgos en salud.

12

Sistema Nacional de Vigilancia Epidemiológica (SINAVE): Corresponde a la Dirección General Adjunta de Epidemiología (DGAE) coordinar la elaboración de las normas y procedimientos para la vigilancia epidemiológica correspondiente. El SINAVE capta, registra y analiza datos de morbilidad, mortalidad y daños, así como riesgos a la salud, en este caso, específicamente para dengue a través del Sistema Único de Información para la Vigilancia Epidemiológica (SUIVE), apoyado a su vez en: - La notificación semanal de casos nuevos de enfermedades - Los sistemas especiales de vigilancia epidemiológica - El Sistema Epidemiológico y Estadístico de las Defunciones (SEED) Caso sospechoso de Fiebre por Dengue o Dengue no Grave: Toda persona de cualquier edad que resida o proceda de una región en la que haya transmisión de la enfermedad y que presente cuadro febril inespecífico o compatible con infección viral. Caso probable de Fiebre por Dengue o Dengue Grave: Todo caso sospechoso que presente fiebre y dos o más de las siguientes características: cefalea, artralgias, mialgias, exantema, dolor reto-ocular. En menores de 5 años, el único signo a considerar puede ser la fiebre. Caso confirmado de Fiebre por Dengue o Dengue no Grave: Todo caso probable en el que se confirme infección reciente por virus de dengue mediante técnicas de laboratorio, esté asociado epidemiológicamente a otro caso confirmado o no se disponga de resultado de laboratorio. Caso probable de Fiebre Hemorrágica por Dengue o Dengue grave: Toda persona que además de un cuadro probable de Fiebre por Dengue, desarrolle fiebre y una o más de las siguientes características: datos de fuga de plasma, o datos de fragilidad capilar, o hemorragias, o trombocitopenia menor a 100,000 plaquetas por mm3 o hemoconcentración con uno a más de los siguientes datos: incremento del hematocrito en un 20% o más en la fase aguda; decremento de hematocrito en al menos 20% después del tratamiento; tendencia del hematocrito en muestras secuenciales (por ejemplo 40, 43, 45 etc.); relación hematocrito/hemoglobina sugestivo 3.2 a 3.4, indicativo 3.5 o mayor; o hipoalbuminemia. Caso confirmado de Fiebre Hemorrágica por Dengue o Dengue grave: Toda persona con cuadro probable de Fiebre Hemorrágica por Dengue confirmado por laboratorio que además presente lo siguiente: Datos de fuga de plasma, con al menos los siguientes datos:  

Clínica: edema, piel moteada, ascitis o derrame pleural Laboratorio: elevación del 20% en etapa aguda o disminución del 20% en etapa de convalecencia o elevación del hematocrito o hemoglobina en forma secuencial (a partir del tercer día) o hipoalbuminemia.

13

 

Gabinete: ultrasonido (líquido peri-visceral y en cavidad abdominal o torácica) o radiología (derrame pleural o ascitis). Datos de fragilidad capilar: prueba de torniquete positiva (petequias, equimosis, hematomas), trombocitopenia menor a 100,000 plaquetas por mm3.

Caso probable de Síndrome de Choque por Dengue (SCHD) o Dengue Grave: Toda persona con cuadro de FD o FHD y que presente súbitamente datos de insuficiencia circulatoria, alteraciones en el estado de conciencia, tensión arterial disminuida o estado de choque profundo. Caso confirmado de Síndrome de Choque por Dengue o Dengue Grave: Todo caso probable de SCHD en el que se confirme infección reciente por virus de dengue mediante técnicas de laboratorio.

OBJETIVO GENERAL Establecer los procedimientos para la implementación del nuevo algoritmo de laboratorio para el diagnóstico de Fiebre por Dengue (FD) y Fiebre Hemorrágica por Dengue (FHD). Objetivos específicos  Brindar información oportuna y veraz al Sistema Nacional de Vigilancia Epidemiológica (SINAVE).  Establecer el manejo adecuado de la información generada por laboratorio, para la toma de decisiones y acciones a través de la RNLSP.  Realizar una rectoría a nivel nacional respecto al diagnóstico de dengue por laboratorio, que indique claramente funciones y responsabilidades en cada nivel.  Conformar una Red Nacional de Laboratorios para el Diagnóstico de Dengue con personal altamente capacitado y con metodologías de actualidad, capaz de responder oportunamente cualquier contingencia a nivel nacional.

14

RED NACIONAL DE LABORATORIOS PARA LA VIGILANCIA DE DENGUE

Figura. 1. Marco analítico para el diagnóstico serológico y molecular de dengue (31 estados) Los estados de color rojo son aquellos que cuentan con la metodología implementada de RT-PCR Multiplex en tiempo real y los de color blanco están en fase de implementación. La estrella color azul indica la implementación de aislamiento viral. Los estados de color verde cuentan con la detección serológica básica mediante detección de antígeno NS1 y anticuerpos IgM y/o IgG.

Organización de la Red Nacional de Laboratorios para el Diagnóstico de Dengue El marco analítico de la Red Nacional de Laboratorios para el Diagnóstico de Dengue está conformado por el diagnóstico serológico (31 LESP realizan determinación de anticuerpos IgM y determinación de antígeno NS1; 23 realizan también determinación de IgG, como marcador de reinfecciones activas, únicamente en regiones endémicas); todos los LESP tienen liberadas las tres metodologías serológicas. Los LESP de Sonora y Veracruz realizan aislamiento viral e identificación de serotipos por Inmunofluorescencia, y 21 LESP tienen implementada y liberada la vigilancia virológica mediante RT-PCR en tiempo real. Actualmente los estados de Coahuila, Estado de México y Puebla, están en fase de implementación y control de calidad de la vigilancia virológica mediante RT-PCR. Los estados de Aguascalientes, Baja California y Tlaxcala, debido a la ausencia del vector, no están considerados para la implementación de la vigilancia virológica; en el Distrito 15

Federal, el InDRE lleva a cabo cualquier identificación de casos importados que viajaron a zonas endémicas de la enfermedad.

Figura. 2. Flujo de trabajo de la Red Nacional de Laboratorios para el Diagnóstico de Dengue

Funciones de los integrantes de la Red Nacional de Laboratorios para el Diagnóstico de Dengue Funciones del laboratorio nacional de referencia El Laboratorio de Arbovirus y Virus Hemorrágicos del InDRE es el laboratorio nacional de referencia y el rector normativo para el diagnóstico de dengue en México. Las funciones que le competen son las siguientes: 

Proporcionar servicios confiables de diagnóstico, referencia y control de calidad de dengue, dentro de los estándares de servicio indicados y ser el laboratorio de excelencia y líder.



Coordinar la Red Nacional de Laboratorios para el Diagnóstico de Dengue mediante un verdadero análisis de la información generada.

16



Promover una visión objetiva y autocrítica, que permita la detección de áreas de oportunidad para implementar mejoras continuas en la determinación de anticuerpos IgM, IgG y antígeno NS1, aislamiento y detección molecular de dengue y otros arbovirus.



Mantener y mejorar algoritmos de diagnóstico y referencia.



Incorporar nuevas metodologías para el diagnóstico diferencial de dengue y otros arbovirus.



Reglamentar los criterios de interpretación de resultados, que permitan generar resultados confiables para la toma de decisiones.



Monitorear continuamente el desempeño de la Red Nacional de Laboratorios para el Diagnóstico de Dengue, mediante la aplicación de los paneles de evaluación externa del desempeño.



Realizar capacitación en el servicio para la formación de recursos humanos altamente capacitados en el diagnóstico de dengue.



Supervisar y asesorar directamente a los LESP.



Desarrollar la investigación operativa y el desarrollo tecnológico que sea aplicable, en apoyo al SINAVE.

Funciones de los laboratorios estatales de salud pública 

Realizar procesos analíticos para la detección de infecciones causadas por dengue.



Asegurar la calidad del diagnóstico en el laboratorio, mediante los procedimientos, métodos y técnicas que el InDRE promueve.



Emitir en tiempo y forma los resultados de los exámenes de laboratorio.



Referir muestras al InDRE para diagnóstico, referencia y control de calidad.



Referir muestras del banco de sueros al InDRE para mantener los paneles de evaluación externa del desempeño.



Generar evidencia y notificar oportunamente al órgano normativo estatal y/o nacional los casos confirmados y descartados.



Participar como mecanismo de apoyo técnico, proporcionando la información relacionada y requerida por el programa sustantivo del área de su competencia.



Seleccionar las muestras para control de calidad del área de influencia del LESP.



Compilar las muestras de las jurisdicciones y redes de apoyo.



Capacitar a epidemiólogos estatales, jurisdiccionales y a todo personal o institución del Sector Salud que lo demande en relación con la toma, manejo y

17

envío de muestras mediante el monitoreo del desempeño en el área de influencia. 

Recabar, analizar y evaluar la información sobre la prestación de servicios de diagnóstico de dengue en su estado.



Supervisar el manejo del equipo asignado al laboratorio conforme a lo establecido en los documentos autorizados y manuales de operación correspondientes para el aseguramiento de la calidad en la red estatal.



Proporcionar información de importancia mediante informes, notas informativas o reportes para que sea difundida a las instancias estatales y nacionales correspondientes contribuyendo a la vigilancia epidemiológica estatal y nacional de manera veraz y oportuna.



Promover la capacitación continua del personal operativo.



Colaborar y/o elaborar trabajos de investigación operativa que proporcione información prioritaria estatal, una vez que los protocolos sean aceptados por los comités de investigación.



Participar en la elaboración y actualización de los manuales técnicos referentes a diagnóstico y temas especializados (bioseguridad, manejo de residuos peligrosos biológico-infecciosos, etc.) para uso en el ámbito estatal y local.

DIAGNÓSTICO DE DENGUE POR LABORATORIO Toma, manejo y envío de muestras clínicas Para el diagnóstico de dengue por laboratorio es necesario contar con suero del paciente, el cual es obtenido a través de una muestra de sangre completa extraída por venopunción, en una cantidad aproximada de 5 mL sin usar anticoagulante; 2.5 mL de suero obtenido deberá ser enviado inmediatamente al LESP para realizar los ensayos correspondientes[1]. La muestra debe mantenerse siempre en refrigeración El sistema básico de triple embalaje consiste en la utilización de un recipiente primario, en el cual está contenida la muestra biológica (exudado faríngeo, exudado nasofaríngeo, lavado bronquio alveolar, biopsia, suero, etc.), el recipiente primario (p. ej. criotubos, tubos o frascos con tapa de rosca) debe ser hermético para evitar que la muestra se derrame y tiene que estar perfectamente etiquetado con el nombre o número de muestra del paciente. El recipiente primario deberá rodearse de material absorbente como gasa o papel absorbente y colocarse en un recipiente secundario hermético a prueba de derrames y golpes. Si se colocan varios recipientes primarios dentro de un recipiente secundario se deberá usar una gradilla y material absorbente para evitar algún derrame. Es importante mencionar que dentro del recipiente secundario (hielera) tiene que haber suficientes refrigerantes para mantener una temperatura de 4 a 8 °C. Los recipientes secundarios deberán llevar las etiquetas de riesgo biológico y señal de orientación del recipiente, a su vez el recipiente secundario deberá ir contenido en un paquete externo de envío (caja de cartón o hielera) que proteja el contenido de elementos externos del ambiente y debe estar 1

18

de 2-8 °C desde el momento de la toma hasta su llegada al LESP. La muestra deberá venir acompañada con el Formato Único de Envío de Muestras Biológicas (REMU-F12) del InDRE, o con el Formato de Enfermedades Transmitidas por Vector o en su caso con el Formato de Informe de Seguimiento de Fiebre por Dengue y Dengue Hemorrágico el cual se genera automáticamente de la plataforma para dengue, con toda la información solicitada, sin datos alterados o sobrescritos, y si es el caso, es conveniente que se indique la gravedad del paciente; las muestras que no cumplan con los requisitos establecidos en el Manual para la Toma, Envío y Recepción de Muestras para Diagnóstico (REMU-MA-01), serán rechazadas sin ninguna excepción. Como todos los LESP ya capturan en el Sistema de Plataforma Única para Dengue se tiene que adjuntar un listado nominal de las muestras enviadas, indicando el folio del SINAVE, de lo contrario las muestras no serán aceptadas. De acuerdo con la Norma Oficial Mexicana NOM-032-SSA2-2010, Para la Vigilancia Epidemiológica, Prevención y Control de las Enfermedades Transmitidas por Vector, las técnicas alternativas para confirmar o descartar un caso probable en los primeros días de haber iniciado con la fiebre (0-5 días) son las técnicas virológicas para detectar y tipificar al virus (aislamiento viral en cultivo de células e identificación por inmunofluorescencia indirecta) o las moleculares (RT-PCR en tiempo real o punto final). A finales del año 2006, apareció una alternativa analítica en formato de ELISA más fácil, rápida y oportuna para aplicar en los primeros días de evolución de la enfermedad. Esta técnica se basa en la identificación de la glicoproteína no estructural 1 del virus dengue (NS1), implicada en los procesos de replicación viral, la cual es secretada por el virus, lo que permite su detección en la muestra de suero en fase aguda de la enfermedad. Esta técnica tiene reportada una sensibilidad entre el 80-100% (dependiente del serotipo y genotipo responsable de la infección, además de la presencia de altas concentraciones de anticuerpos IgM o IgG) y una especificidad de 100% y que conjuntamente con las técnicas comerciales ya existentes para determinación de IgM (sensibilidad de 94.7% y especificidad del 97.2%) y para determinación de IgG de segundas infecciones o reinfecciones por serotipos distintos (sensibilidad del 94.5% y especificidad del 97.3%) serán las pruebas consideradas como básicas en la implementación del nuevo algoritmo. Para realizar los tres ensayos inmunoenzimáticos se necesita contar con: un gabinete de bioseguridad tipo II, un lector de ELISA para placas completas con un filtro de 450 nm y otro de referencia entre 600-650 nm, un lavador para placas completas, una incubadora o baño María (28-37 °C) y micropipetas multicanales y sencillas con diferentes volúmenes, además de todo el material requerido no incluido en los estuches de diagnóstico. Los procedimientos se deben realizar como

etiquetado con los datos del remitente, destinatario y señal de orientación. La documentación que se integre al triple embalaje deberá colocarse en la parte interior del paquete.

19

lo indican las técnicas correspondientes para poder cumplir con la validación de cada ensayo. Es importante aclarar que las muestras a procesar por cualquiera de estas técnicas se deben manejar en estricta red fría, es decir que no deben permanecer a temperatura ambiente, para lo cual se sugiere sacar las muestras del refrigerador hasta el momento de realizar cada procedimiento y una vez terminado el uso de las mismas se deben mantener almacenadas a 4 °C. De ser posible, se recomienda que para el manejo de las muestras (ya sea al momento de rotularlas, usarlas en cada técnica y separar en alícuotas) se coloque la gradilla sobre una cama de hielo o de refrigerantes congelados. En caso de manejar un gran número de muestras por corrida (arriba de 50), deberá hacerse en bloques de 25 o 30 muestras para asegurar la red fría y se deberán cambiar los congelantes y el hielo durante cada bloque. El énfasis para el manejo de muestras en estrictas condiciones de red fría radica en aumentar las posibilidades de aislamiento viral y detección de material genético, ya que los cambios de temperatura promueven la degradación de las proteínas de superficie de la partícula viral, así como para evitar la degradación del ARN (ácido ribonucleico) del virus que es altamente termolábil e inestable.

Algoritmo de laboratorio para el diagnóstico de dengue El algoritmo propuesto para el diagnóstico de dengue deriva de tres premisas básicas: 1) La necesidad de mejorar el porcentaje de casos confirmados por laboratorio con respecto a los casos probables utilizando una sola muestra. 2) La necesidad de contar con un diagnóstico oportuno, que promueva una completa y mejor vigilancia virológica en el país. La implementación del algoritmo apoyará el Programa Nacional de Prevención y Control del Dengue al contar con información veraz, oportuna y de calidad para iniciar las intervenciones adecuadas. 3) Identificar aquellas muestras que no son dengue y promover el diagnóstico diferencial. Este algoritmo fue consensuado en cuatro diferentes reuniones celebradas en México entre los laboratorios de la RNLSP y el InDRE. También fue sometido a la crítica de expertos internacionales en la reunión Américas Dengue Prevention Board–Dengue Surveillance, celebrada en la Ciudad de México del 17 al 19 de enero de 2008. Durante los días 26 al 29 de febrero del mismo año se realizó, en instalaciones del InDRE, el “Taller teórico-práctico para la implementación del nuevo algoritmo para el diagnóstico por laboratorio para dengue”, el cual fue dirigido a los 31 laboratorios estatales que conforman la RNLSP. Los últimos comentarios se discutieron durante la visita de evaluación del Programa Nacional de Prevención y Control del Dengue en México por parte de la Organización Panamericana de la Salud, del 24 de marzo al 2 de abril de 2008. La solicitud por 20

parte del InDRE a la RNLSP fue iniciar la implementación del algoritmo a partir del mes de abril de 2008. Este algoritmo involucra la calidad y la oportunidad de la información generada por el componente de laboratorio que coadyuva en la prevención y control del dengue; el algoritmo se muestra en la figura 3.

Figura. 3. Algoritmo de laboratorio para el diagnóstico de dengue. Clave de tabulador: 1A3512001, 1A3512002, 1A3512003 y 1A3512004 El algoritmo involucra tres técnicas serológicas básicas: NS1, IgM e IgG. La determinación de antígeno NS1 aplica únicamente en fase aguda de la enfermedad; las determinaciones de anticuerpos IgM e IgG son aplicadas en la fase aguda y convaleciente. La vigilancia virológica deberá ser aplicada en al menos el 10% de las muestras de FD NS1+ y en el 100% de las FHD NS1+ en los LESP que tengan liberada la metodología y para los que no cuenten con ella, deberán enviarlas al InDRE para tipificación. Todas las muestras para diagnóstico diferencial deberán cumplir con definición de caso para cada agente etiológico a estudiar.

21

Algoritmo diagnóstico serológico A. Muestras recibidas en el laboratorio entre 0-5 días de haber iniciado la fiebre Resultado Metodología serológica

D eterminación del antígeno viral (NS1) por ELISA (Platelia BIORAD, Catálogo 72830 o Early ELISA NS1 Inverness M edical Innovations, Catálogo E-DEN02P)

D eterminación de IgM por ELISA (Panbio No. catálogo E-DEN01M ), únicamente para las muestras que tengan entre 4-5 días de haber iniciado la fiebre.

D eterminación de IgG por ELISA (Panbio, No. de catálogo E-DEN02G), únicamente para muestras que estén entre 0-3 días, infección reciente (infecciones secundarias).

Positivo

Negativo

Confirma caso. El laboratorio reportará este resultado y se dará por terminado el algoritmo. NO se realizará ninguna otra prueba ni se reportará ningún otro resultado (a excepción del serotipo identificado por RT-PCR, si es que fue seleccionada para la vigilancia virológica). E l valor reportado que representa a un positivo es mayor o igual a 1.0 unidad.

E l laboratorio reportará el resultado y se realizará la siguiente prueba indicada en el algoritmo: ELISA para IgG (cuando la muestra tenga 0-3 días de iniciada la fiebre) o ELISA para IgM (cuando la muestra tenga 4-5 días de iniciada la fiebre).

Confirma caso. El laboratorio reportará este resultado y se dará por terminado el algoritmo. NO se realizará ninguna otra prueba ni se reportará ningún otro resultado. E l valor reportado que representa a un positivo es mayor o igual a 11.0 unidades.

E l laboratorio reportará el resultado y realizará la determinación de IgG.

Confirma caso. Este resultado precisa que bajo el diseño de la prueba, permite identificar concentraciones muy altas del marcador a analizar, que representan infección reciente y activa como sinónimo de una reinfección por dengue pero por un serotipo diferente al de la primera infección. E l laboratorio reportará este resultado y se dará por terminado el algoritmo. NO se realizará ninguna otra prueba ni se reportará ningún otro resultado. E l valor reportado que representa a un positivo es mayor o igual a 22.0 unidades.

E l laboratorio reportará este resultado, asegurando que todas las pruebas antes mencionadas fueron realizadas y tuvieron un resultado negativo. Se dará por terminado el algoritmo. El valor reportado que representa a un negativo es menor o igual a 18.0 unidades.

Una muestra negativa a las tres pruebas previas (NS1, IgM, IgG) se considera negativa a dengue y se deberá realizar diagnóstico diferencial para otras arbovirosis, las muestras serán enviadas al InDRE con base en el diagnóstico clínico y previa solicitud de vigilancia epidemiológica estatal (para casos graves y defunciones), ya sea para identificación de flavivirus no dengue o alfa virus como: Virus del Oeste del Nilo, Encefalitis de San Luis, Fiebre Amarilla, Encefalitis Equina del Oeste, Encefalitis Equina del Este, Encefalitis Equina Venezolana y Virus Chikungunya (CHIKV); además de Enfermedad Febril Exantemática, Leptospira, Rickettsia o Hantavirus (en caso de signos hemorrágicos). En 22

noviembre del 2012 la RNLSP recibió la capacitación para iniciar la realización del diagnóstico diferencial serológico y molecular de arbovirosis y con esto comenzar a implementar la “ARBO-RED” en México. Ante casos de fiebre icterohemorrágica se sugiere realizar diagnóstico diferencial con Fiebre Amarilla a personas que viajaron a zonas endémicas. En zonas endémicas para leptospira se sugiere realizar la prueba rápida al mismo tiempo que se inicie con el algoritmo de dengue. Una vez que se cuente con los diagnósticos implementados se ofrecerán al SINAVE y en el momento que este lo considere pertinente, se realizará en el InDRE la detección ampliada para otras familias de arbovirus identificados en las Américas, como Bunyanvirus (virus Oropuche, La Crosse), Arenavirus hemorrágicos (virus Machupo, Guaranito, Junin, Lassa).

B. Muestras recibidas en el laboratorio con ≥6 días de haber iniciado la fiebre Metodología serológica

D eterminación IgM

por

ELISA

D eterminación IgG

por

de

de

ELISA

Resultado Positivo

Negativo

Confirma caso. El laboratorio reportará este resultado, y se dará por terminado el algoritmo. NO se realizará ninguna otra prueba ni se reportará ningún otro resultado. El valor reportado que representa a un positivo es mayor o igual a 11.0 unidades.

El laboratorio reportará el resultado y realizará la siguiente prueba indicada en el algoritmo. En este caso será determinación de IgG.

Confirma caso. Este resultado precisa que bajo el diseño de la prueba, permite identificar concentraciones muy altas del marcador a analizar, que representan infección reciente y activa como sinónimo de una reinfección por dengue pero por un serotipo diferente al de la primera infección. El laboratorio reportará únicamente este resultado y se dará por terminado el algoritmo. NO se realizará ninguna otra prueba ni se reportará ningún otro resultado. El valor reportado que representa a un positivo es mayor o igual a 22.0 unidades.

El laboratorio reportará este resultado, asegurando que las dos pruebas fueron realizadas y tuvieron un resultado negativo. En este momento se da por terminado el algoritmo. El valor reportado que representa a un negativo es menor o igual a 18.0 unidades.

23

Una muestra negativa a las dos pruebas previas (IgM, IgG) se considera negativa a dengue y se deberá realizar diagnóstico diferencial, las muestras serán enviadas al InDRE con base en el diagnóstico clínico y previa solicitud de vigilancia epidemiológica estatal (para casos graves y defunciones), ya sea para identificación serológica de flavivirus no dengue o alfa virus como: Virus del Oeste del Nilo, Encefalitis de San Luis, Fiebre Amarilla, Encefalitis del Oeste, del Este y Venezolana, y virus Chikungunya; además de Enfermedad Febril Exantemática, Leptospira, Rickettsia o Hantavirus (en caso de signos hemorrágicos). Ante casos de fiebre icterohemorrágica, se sugiere realizar diagnóstico diferencial con Fiebre Amarilla a personas que viajaron a zonas endémicas. En zonas endémicas para leptospira se sugiere realizar la prueba rápida al mismo tiempo que se inicie con el algoritmo de dengue. Se solicitará realizar otros diagnósticos pertinentes, según considere el SINAVE.

Resultados indeterminados En caso de que se obtengan resultados “indeterminados” por alguna de las técnicas mencionadas anteriormente se procederá de la siguiente forma:

Metodología serológica

D eterminación

de

NS1

Resultado indeterminado

por

ELISA

D eterminación

de

IgM

por

ELISA

D eterminación de IgG por ELISA

No se reportará el resultado como indeterminado y se procesará nuevamente la muestra por duplicado como lo indica la técnica, y si se obtiene el mismo resultado (indeterminado) se realizará la siguiente prueba indicada en el algoritmo según corresponda. Este resultado se reportará en plataforma una vez que esté activo el campo de resultado indeterminado. No se reportará el resultado como indeterminado y se procesará nuevamente la muestra por duplicado como lo indica la técnica y si se obtiene el mismo resultado (indeterminado) se realizará la siguiente prueba indicada en el algoritmo según corresponda. Este resultado se reportará en plataforma una vez que esté activo el campo de resultado indeterminado. No se reportará el resultado como indeterminado y se procesará nuevamente la muestra por duplicado como lo indica la técnica y si se obtiene el mismo resultado (indeterminado) se enviará al InDRE para referencia ya que a partir de septiembre se realizará inhibición de la hemaglutinación (IH ) y una vez estandarizada la metodología de microneutralización (M NT) se incorporarán las dos metodologías como referencia para estos resultados. El resultado se reportará en plataforma una vez que esté activo el campo de resultado indeterminado. El InDRE reportará sus resultados de referencia una vez que en plataforma se encuentren activos los campos para IH y M NT.

Cualquier otra metodología diferente a la indicada y que no esté evaluada por el InDRE para la vigilancia serológica, NO será considerada válida y los resultados

24

obtenidos NO serán avalados, hasta no ser enviadas al InDRE las muestras de interés.

Determinación de material genético mediante RT-PCR Multiplex en tiempo real Esta técnica aplica únicamente en muestras NS1 positivas que fueron seleccionadas para su tipificación. Resultado

Metodología serológica

D eterminación mediante RT-PCR Multiplex

en

tiempo

real

Positivo

Negativo

Se reportará el serotipo identificado o serotipos identificados. El laboratorio tendrá que informar el resultado obtenido al remitente de la muestra según sea el caso. Cabe aclarar que las muestras que resultaron positivas por RT-PCR M ultiplex en tiempo real ya habían sido confirmadas mediante determinación de antígeno NS1, por lo que deberá ser considerado como único caso confirmado. Esta metodología solamente tiene el objetivo de realizar la vigilancia virológica de serotipos circulantes en M éxico.

El laboratorio también deberá informar este tipo de resultado. Cabe aclarar que las muestras que resultaron negativas por RT-PCR M ultiplex en tiempo real ya habían sido confirmadas mediante determinación de antígeno NS1, por lo que deberá ser considerado como único caso confirmado.

El estándar de servicio para RT-PCR es de 3 días. En caso de extrema urgencia, los resultados deberán ser emitidos en 24 horas una vez recibida la muestra en el Laboratorio de Arbovirus y Virus Hemorrágicos del InDRE o en el LESP.

Vigilancia entomo-virológica mediante RT-PCR Multiplex en tiempo real Esta nueva vigilancia es consecuencia de las necesidades que han sido identificadas por la Coordinación de Enfermedades Virales Zoonóticas y por Vector del InDRE (CEZV-InDRE) y las exigencias que plantea la enfermedad, y son el efecto de la implementación de la Epidemiología Inteligente basada en laboratorio que permite coadyuvar con el programa de vectores para lograr una verdadera vigilancia epidemiológica oportuna y preventiva. Durante 2011 se capacitaron los LESP de Oaxaca, Morelos, San Luis Potosí, Nuevo León, Guerrero, Chiapas, Guanajuato y Zacatecas, los cuales fueron seleccionados por contar con los componentes

25

entomológicos y virológicos. En el caso de que algún otro LESP, haga saber al InDRE que cuenta con los dos componentes, este será seleccionado para la capacitación de vigilancia entomo-virológica. En julio de 2102 se realizó una capacitación vía Webex a toda la RNLSP para la implementación de este tipo de técnica. 1. Esta vigilancia será realizada únicamente por aquellos LESP que tengan liberada la metodología de RT-PCR Multiplex en tiempo real y que cuenten con la contraparte entomológica, los cuales se harán cargo de la captura y clasificación de los especímenes, estos deberán ser entregados en red fría o vivos, según sea el caso, al área responsable de la vigilancia virológica y está podrá llevar a cabo el macerado y clarificado de los especímenes. Este tipo de vigilancia se realizará en grupos con número de especímenes menores a 30. 2. El tipo de muestra para la vigilancia entomo-virológica puede ser de larvas o mosquitos adultos, de estos últimos es la más indicada. 3. En caso de captura de huevecillos, estos deberán ser cultivados para obtener mosquitos adultos; análisis que servirá para determinar zonas con transmisión vertical. Actualmente la CEZV-InDRE está realizando la estandarización de la detección directa en huevecillos. 4. El LESP es el responsable de notificar inmediatamente al InDRE y al Programa de Vectores de los resultados obtenidos, para la toma de acciones pertinentes. 5. Como seguimiento de los resultados, el LESP deberá enviar al InDRE el 100% de sus clarificados positivos y el 10% de los negativos, esto NO representa un control de calidad, únicamente servirá para tener un banco de clarificados de especímenes. El control de calidad aplicará cuando se identifique un serotipo diferente al circulante en ese momento. El estándar de servicio será de 5 días una vez que los especímenes sean recibidos en los LESP.

26

Aislamiento e identificación inmunofluorescencia indirecta

de

serotipos

mediante

Resultado

Aislamiento e identificación de serotipos

Positivo

Negativo

Inmunofluorescencia Indirecta

Se reportará el serotipo o serotipos identificados. El laboratorio que cuente con la metodología correspondiente tendrá que informar el resultado obtenido al remitente de la muestra, según sea el caso. Cabe señalar que las muestras que resultaron positivas para aislamiento viral, ya habían sido confirmadas mediante determinación de antígeno NS1, por lo que deberá ser considerado como único caso confirmado.

El laboratorio también deberá informar el resultado. Cabe mencionar que las muestras que resultaron negativas para aislamiento viral, ya habían sido confirmadas mediante determinación de antígeno NS1, por lo que deberá ser considerado como único caso confirmado.

Todos los resultados negativos por esta metodología deberán ser corroborados mediante RT-PCR Multiplex en tiempo real. Para aquellos laboratorios que estén realizando aislamiento viral como técnica para la vigilancia virológica de dengue y que requieran de una evaluación mediante paneles por parte del InDRE, deberán realizar la solicitud por escrito y dirigida a la Dirección de Servicios y Apoyo del InDRE para que se les asigne un panel especial para esta metodología.

Uso de pruebas rápidas para el diagnóstico Durante situaciones de emergencia por brotes de dengue, como en las inundaciones, hay sitios inaccesibles y el exceso de muestras satura al LESP, por lo que se requiere contar con un diagnóstico oportuno y confiable y con soporte costobeneficio. Para ello, se propone un algoritmo que permita confirmar casos de una forma rápida y práctica con el uso de pruebas rápidas, las cuales reportan una sensibilidad y especificidad superior al 70%. La decisión de cuándo usar este tipo de pruebas será con base en el Manual de Vigilancia Epidemiológica de Dengue y debe ser definida por vigilancia epidemiológica estatal, previa autorización de la DGAE del nivel federal. Este tipo de metodología deberá ser realizada únicamente por los LESP. De no ser en estas situaciones se deberán realizar las pruebas indicadas en el algoritmo vigente.

27

Resultado

Prueba rápida

D engue D úo Cassette (Panbio, No. de catálogo E-DEN01D). Esta prueba está diseñada para analizar los marcadores IgM e IgG y deberá ser utilizada según algoritmo vigente.

SD -D engue D úo (Dengue NS1 y anticuerpos IgM -IgG) (Panbio, No. de catálogo 11FK45 y 46. Es una prueba inmunocromatográfica de un paso diseñada para detectar el antígeno del virus del dengue NS1 y los anticuerpos contra el virus del dengue (dengue IgG/IgM ) de manera cualitativa y diferencial en sangre total, suero y plasma. Es el primer y único producto a nivel mundial con formato para los tres marcadores serológicos indicados en el algoritmo vigente. Contrarresta la debilidad de solamente una prueba.

Positivo

Negativo

Confirma caso. El laboratorio reportará este resultado. Se realizará una selección aleatoria, para que en uno de cada 10 casos positivos se siga el procedimiento del algoritmo vigente. El resultado se reportará en plataforma una vez que estén activos los módulos de resultado para prueba rápida.

Se reportará el resultado en plataforma una vez que estén activos los módulos de resultado para prueba rápida. La muestra deberá ser procesada siguiendo el algoritmo vigente con base en los días de evolución.

Positivo a cualquiera de los tres marcadores: confirma caso. El laboratorio reportará este resultado. Se realizará una selección aleatoria, para que en uno de cada 10 casos positivos se siga el procedimiento del algoritmo vigente. El resultado se reportará en plataforma una vez que estén activos los módulos de resultado para prueba rápida. En caso de IgG positivos, estos evidencian la presencia de reinfecciones activas por serotipos diferentes a la primera infección, como en el formato de ELISA.

Negativo para los tres marcadores: Se reportará el resultado en plataforma una vez que estén activos los módulos de resultado para prueba rápida. La muestra deberá ser procesada siguiendo el algoritmo vigente con base en los días de evolución.

Cualquier otra metodología diferente a la indicada y que no esté evaluada por el InDRE aunque cumpla con los requerimientos para la vigilancia serológica NO será considerada válida y los resultados obtenidos NO serán avalados, hasta no ser enviadas al InDRE las muestras de interés.

Si el InDRE tuviera la evaluación de cualquier otra técnica y está cumpliera con los estándares requeridos para ser usada en el diagnóstico de dengue en México, se informará inmediatamente a los LESP para ser utilizada en la vigilancia epidemiológica bajo los estándares del uso de pruebas rápidas.

Muestras de defunciones La CEZV-InDRE, con el objetivo de brindar mayor información al CONAVE y al Comité Estatal de Vigilancia Epidemiológica (CEVE) y un mejor dictamen de defunciones, da la indicación que las muestras de suero de defunciones por probable FHD deberán ser procesadas por los LESP. Para los tres marcadores NS1, IgM e IgG, en caso de muestras en fase aguda; y para los dos marcadores IgM e IgG, en caso de muestras de fase convaleciente. En el caso de las biopsias post mórtem estas deberán ser analizadas mediante RT-PCR Multiplex en tiempo real.

28

Se deben enviar al InDRE únicamente las muestras con resultado negativo para todos los marcadores serológicos o moleculares para dengue con la finalidad de realizar diagnósticos diferenciales para otros arbovirus, basándose en el cuadro clínico (hemorrágico, neurológico etc.) Para el dictamen de defunciones en los CEVE y el CONAVE se tomarán en cuenta solo los resultados obtenidos en los LESP. Si se presenta el caso, el InDRE notificará los resultados del diagnóstico diferencial a los LESP. Si se requiere el envío de las muestras al InDRE por alguna circunstancia determinada en el CONAVE, se solicitará al LESP el envío de las muestras. Para aquellos laboratorios que obtengan clasificación No aceptable en la evaluación del desempeño, deberán enviar todas las muestras de defunciones al InDRE (100% de positivas y negativas) hasta que la clasificación en la evaluación del desempeño sea aprobatoria, y se emita un documento al LESP en cuestión, en el cual se indique que se suspende el envío de muestras de defunciones al InDRE ya que el diagnóstico se realizará nuevamente en el LESP. El estándar del servicio para emitir un resultado será de 5 días hábiles

ESTÁNDAR DE CALIDAD Estándar de servicio para la notificación de los resultados

Fase pre-analítica Esta fase está relacionada con la toma de muestra, manejo y envío de la misma al laboratorio. Para cumplir con esta parte, todas las muestras requeridas para realizar la detección de infecciones causadas por cualquiera de los cuatro serotipos del virus dengue deberán cumplir con las definiciones de caso probable para FD y FHD, además de cumplir con los requisitos establecidos como lo indica el Manual para la Toma, Envío y Recepción de Muestras para Diagnóstico del InDRE (REMUMA-01), de lo contrario las muestras serán rechazadas. A continuación se anexa un cuadro con el resumen de estas especificaciones.

29

Cuadro 1. Especificaciones de las muestras Tipo de muestra

Volumen

Condiciones de manejo y envío

Biopsia de hígado, bazo, ganglios, etc.

M uestras de mosquitos (clarificados o adultos)

Características

almacenaje

requerido

Suero

Condiciones de

M ínimo 500 µL

Tubos tipo eppendorf o crioviales con capacidad para 2.0 mL, etiquetados con nombre y folio. Acompañados con los formatos correspondientes y el oficio de solicitud

En estricta refrigeración (2-8 °C)

Sin contaminación bacteriana o fúngica, no hemolizadas, ni lipémicas.

1 cm3

En frascos estériles, con solución 0.85% (solución al salina fisiológica) identificados con nombre y tipo de tejido. Acompañados con los formatos correspondientes y el oficio de solicitud.

En estricta refrigeración (2-8 °C)

No usar formol

En estricta refrigeración (2-8 °C)

Clarificado sin evidencias de contaminación bacteriana o fúngica

0.5 mL de clarificado o grupos de 30 especímenes adultos.

Para clarificados: tubos tipo eppendorf o crioviales con mL, 2.0 para capacidad etiquetados con clave o folio. Para adultos: tubos cónicos de 15 o 50 mL etiquetados con clave o folio. En ambos casos se enviarán los formatos que se indicaron en debidamente webex, sesión requisitados.

Fase analítica En esta fase se considera la aplicación del algoritmo de diagnóstico como está indicado, además de cumplir con el tiempo establecido para el reporte de resultados, sin tomar en cuenta la vigilancia virológica hasta finalizar con el algoritmo, es decir, hasta la realización de IgG (si fuera el caso) que será de 3 días hábiles. En caso de emergencia epidemiológica cada LESP deberá elaborar un plan de respuesta rápida en el que incluya laborar todos los días de la semana. Fase post-analítica El reporte de resultados deberá ser generado inmediatamente después de que se tenga el resultado correspondiente. En caso de estar dentro de la fase de control de calidad para alguna de las metodologías, los resultados deberán ser reportados únicamente cuando el InDRE emita el informe de prueba al LESP correspondiente. Con el objetivo de conocer a nivel nacional toda la información generada en cada laboratorio y que esta pueda ser conocida y consultada por las autoridades del

30

InDRE y para los fines que requieran el Programa Nacional de Vectores y la DGAE, es obligatorio que se tenga y se aplique correctamente el sistema de información. PLATAFORMA ÚNICA DE DENGUE Captura de datos y resultados A partir de la difusión de estos lineamientos y con el objetivo de conocer la eficiente aplicación y costos de la implementación del algoritmo, en común acuerdo con la CEZV-InDRE y el Departamento de Enfermedades Transmisibles por Vector de la DGAE, se deben reportar en la plataforma todos los resultados obtenidos de las muestras analizadas, según sea el caso. Ejemplo: para las muestras en fase aguda con menos de 3 días de evolución con resultado negativo a NS1 e IgG, se deben reportar los dos resultados, o en caso de un resultado negativo a NS1 y positivo a IgG también se deben reportar los dos, de acuerdo con las indicaciones del algoritmo vigente. Los resultados obtenidos deberán ser reportados inmediatamente (dentro de las siguientes 24 horas) en la plataforma única para dengue, siguiendo las indicaciones del Manual de Usuario para la Plataforma Única. Módulo Dengue. En la siguiente dirección se podrá ingresar a la plataforma www.rhove.gob.mx

Información relacionada con la plataforma única para dengue Para reportar los resultados en la plataforma única para dengue el LESP, el laboratorio local y el InDRE tienen acceso a este sistema mediante la solicitud de una clave de acceso o usuario la cual es proporcionada por vigilancia epidemiológica estatal o federal. El apartado correspondiente al laboratorio se describe a continuación.

Estudios de laboratorio La posibilidad del análisis de laboratorio está en función de las técnicas empleadas para el diagnóstico. Se deberá llenar el procedimiento de laboratorio específico para cada caso, por lo que es necesario ingresar la fecha de toma de la muestra y cada LESP tiene la atribución de ingresar el resultado obtenido, la fecha de recepción de la muestra y la fecha en que se está reportando, así como la obligación de revisar que se cuenta con toda la información que se requiere para poder realizar el diagnóstico de forma oportuna. Las fechas de toma y recepción de muestra, y de resultado son obligatorias. El LESP recibirá el oficio de solicitud para el diagnóstico junto con el listado de muestras enviadas (con número de folio de identificación para la plataforma y nombre), no se recibirán las muestras que no tengan el folio de plataforma o que falte algún dato de laboratorio que se requiera para aplicar el algoritmo. Con estos datos el laboratorio realizará la búsqueda en la opción de “seguimiento” al ingresar 31

con su clave en plataforma única, podrá reportar los resultados obtenidos de cada muestra recibida por cualquiera de las técnicas siguientes: determinación de NS1, determinación de IgM, determinación de IgG con base en el algoritmo. También se podrá reportar aislamiento (para aquellos laboratorios que lo realicen), RT-PCR Multiplex en tiempo real o prueba rápida (previa autorización de su uso). La CEZVInDRE está promoviendo la actualización de la plataforma a partir del primer semestre del 2013 para brindar una mejor calidad de la información. La variable “muestra” se refiere al paciente que ya cuenta con muestra para realizar el diagnóstico por laboratorio. Es importante mantener actualizado este dato ya que la plataforma considera esta variable para estimar el porcentaje de muestreo además del porcentaje de positividad.

Reporte de resultados obtenidos por las siguientes técnicas: a) ELISA para determinación de NS1 1. Anotar o seleccionar del menú la fecha de toma de la muestra. 2. Anotar la fecha de recepción de la muestra en el LESP, una vez que el campo se habilite en plataforma. 3. Anotar o seleccionar del menú la fecha de reporte del resultado. 4. Seleccionar el resultado:  Si resulta positivo se selecciona + y NO se reportará nada más, a excepción de que posteriormente se agregue el resultado con el serotipo identificado si fuera el caso, como se mencionó previamente. Este resultado se debe capturar inmediatamente.  Si resulta negativo se selecciona (-) y se reportará el resultado inmediatamente. El laboratorio deberá realizar la siguiente prueba indicada en el algoritmo. b) ELISA para determinación de IgM 1. Anotar o seleccionar del menú la fecha de toma de la muestra. 2. Anotar la fecha de recepción de la muestra en el LESP, una vez que el campo se habilite en plataforma. 3. Anotar o seleccionar del menú la fecha de reporte del resultado. 4. Seleccionar el resultado:  Si resulta positivo se selecciona + y NO se reportará nada más. Este resultado se debe capturar inmediatamente.  Si resulta negativo se selecciona (-) y se reportará el resultado inmediatamente. El laboratorio deberá realizar la siguiente prueba indicada en el algoritmo. c) ELISA para determinación de IgG 1. Anotar o seleccionar del menú la fecha de toma de la muestra. 2. Anotar la fecha de recepción de la muestra en el LESP, una vez que el campo se habilite en plataforma. 32

3. Anotar o seleccionar del menú la fecha de reporte del resultado. 4. Seleccionar el resultado:  Si resulta positivo se selecciona + y NO se reportará nada más. Este resultado se debe capturar inmediatamente.  Si resulta negativo se selecciona (-) y se da por terminado el algoritmo, con lo que se comprueba que todas las pruebas antes mencionadas ya fueron realizadas y resultaron negativas, por lo tanto el caso se descarta por laboratorio. Recordar que TODOS los resultados antes obtenidos deben ser reportados. d) Aislamiento viral y RT PCR en tiempo real 1. En caso de que se requiera ingresar resultados en este rubro, la fecha de toma de la muestra deberá ser la misma que la fecha que se anotó o seleccionó en el rubro de NS1, ya que será la misma muestra para identificar serotipo. 2. Anotar la fecha de recepción de la muestra en el LESP, una vez que el campo se habilite en plataforma. 3. Anotar o seleccionar del menú la fecha de reporte del resultado, que será emitido por el InDRE o por el LESP que tenga implementadas las técnicas para identificar serotipos. 4. Seleccionar el o los serotipos identificados (1, 2, 3 o 4).

1. 2. 3. 4.

e) Prueba rápida: siempre y cuando esté aprobado el uso de la misma según resultados de sensibilidad y selectividad Anotar o seleccionar del menú la fecha de toma de la muestra. Anotar la fecha de recepción de la muestra en el LESP, una vez que el campo se habilite en plataforma. Anotar o seleccionar del menú la fecha de reporte del resultado. Seleccionar el resultado (+) o (-).

Es responsabilidad del LESP revisar la información que está en la plataforma semanalmente y verificar que las muestras asignadas por epidemiología estatal se encuentren en el laboratorio o de lo contrario indicar en el rubro correspondiente que no se tomó la muestra, ya que aparecerán como no realizadas. En su momento se modificará el módulo para verificar que las muestras registradas son, efectivamente, las que se tienen en el LESP. En el caso de los informes de serotipos identificados, estos serán avalados semanalmente por el InDRE mediante análisis de datos obtenidos en la plataforma única módulo de dengue y al envío del informe semanal al Laboratorio de Arbovirus y Virus Hemorrágicos; el corte se realizará los lunes a las 12:00 horas. Esta información será manejada por el InDRE, la DGAE y el Programa de Vectores, para homogeneizar la información que se publicará en el Boletín Semanal de Epidemiología.

33

PROGRAMA DE EVALUACIÓN EXTERNA DEL DESEMPEÑO (PEED) Para la evaluación del desempeño se establecieron los ensayos de aptitud, que constituyen una herramienta de aseguramiento de la calidad, la cual permite a los laboratorios monitorear su desempeño, comparar sus resultados con laboratorios similares, evaluar la competencia en el desarrollo de sus pruebas e identificar áreas de oportunidad. Dentro de los ensayos de aptitud se encuentran los PEED, herramienta que utiliza el InDRE para la evaluación continua de la competencia técnica y la identificación de necesidades de fortalecimiento de un individuo, de un grupo de laboratorio o de las redes de diagnóstico específico mediante el envío a intervalos regulares continuos de paneles de muestras caracterizadas. El uso de los PEED como auxiliares en la evaluación del desempeño de los laboratorios de la RNLSP requiere que operen correctamente y en armonía con los requerimientos de desarrollo de las redes de diagnóstico. Como parte importante del plan de mejora de los PEED es que se implementaron los paneles que evalúan de manera integral el desempeño del algoritmo de laboratorio para el diagnóstico de dengue. Indicadores técnico-administrativos que competencia técnica de los laboratorios.

permiten

conocer

la

La CEZV-InDRE ha promovido dentro de este lineamiento para dengue, los paneles independientes -serológicos y moleculares- los cuales eran (julio del 2012) PANELES INTELIGENTES O ALGORÍTMICOS y a partir del 2013 son paneles algorítmicos únicos “SMART-ONLY-DEN” en los que se evalúa en un mismo panel TODO el algoritmo es decir, se analizarán muestras para serología y biología molecular siguiendo las indicaciones e instrucciones para cada muestra y bajo indicaciones del algoritmo de diagnóstico vigente.

A. Laboratorios que pertenecen a la Red Nacional de Laboratorios para el Diagnóstico de Dengue El procedimiento para estos laboratorios se realizará de la siguiente forma: 1. Envío de un primer panel de eficiencia (durante el primer semestre del año). Conformado para la determinación de anticuerpos tipo IgM, IgG y antígeno NS1 y tipificación viral según los resultados de muestras identificadas como NS1 positivas, dependiendo de la regionalización del marco analítico en cada LESP. 2. Envío de un segundo panel de eficiencia (durante el segundo semestre del año). Conformado para la determinación de anticuerpos tipo IgM, IgG y antígeno NS1 y tipificación viral según los resultados de muestras identificadas como NS1 positivas, dependiendo de la regionalización del marco analítico en cada LESP.

34

El formato del panel se basa en el algoritmo de diagnóstico vigente, en la determinación de los tres componentes serológicos y el molecular, en el cual se pondrá a prueba el marco analítico de cada LESP (paneles inteligentes únicos). A partir del segundo ciclo de la evaluación del desempeño en 2012, se enviaron paneles para evaluar el algoritmo vigente y no metodologías por separado; se enviaron muestras de suero codificadas, las cuales fueron procesadas según el algoritmo, basándose en los días de evolución de la enfermedad indicados en el instructivo del Laboratorio de Arbovirus y Virus Hemorrágicos. Como se mencionó anteriormente, a partir del primer ciclo de paneles del 2013 se incorporó en este tipo de paneles los de NAT-DEN (RT-PCR Multiplex en tiempo real), en los cuales se incluye la tipificación de virus dengue de aquellas muestras positivas a NS1, tal y como lo indica el algoritmo. Este tipo de panel además evaluará en la metodología molecular, la capacidad de los analistas para obtener datos de pendiente que identifican la eficiencia de la reacción, las fallas en el pipeteo que puedan promover errores y la capacidad de interpretación de curvas de amplificación en muestras con coinfección por dos serotipos. Esto permitirá a la CEZV-InDRE clasificar a algunos LESP como de EXCELENCIA, que tendrán el beneficio de participar activamente en investigación epidemiológica aplicada para brindar al SINAVE conocimiento de dengue y otros arbovirus. Con base en los resultados de concordancia obtenidos en los paneles se clasificará a los LESP como sigue: 1. LESP que hayan obtenido una calificación de 90.0 a 100% de concordancia serán clasificados como sobresalientes. 2. LESP que hayan obtenido una calificación de 80.0 a <90% de concordancia serán clasificados como satisfactorios. 3. LESP que hayan obtenido una calificación <80% de concordancia serán clasificados como no aceptables. Para los laboratorios que obtengan clasificación Sobresaliente o Satisfactoria se procederá de la siguiente forma: a) Ya no enviarán muestras para Control de Calidad al InDRE de cualquier técnica empleada en el LESP (determinación de IgM, IgG, NS1 o de PCR). Esto se notificará al director del LESP vía oficio emitido por la Dirección de Diagnóstico y Referencia del InDRE. b) La evaluación del desempeño se realizará únicamente a través de paneles, que serán enviados 2 veces por año. Para los laboratorios que obtengan clasificación No aceptable, se procederá de la siguiente forma: a) Se solicitará la elaboración de un plan de mejora que deberán enviar al InDRE en un tiempo no mayor a una semana después de la notificación de esta clasificación. b) El InDRE analizará el plan de mejora y de no cumplir con las expectativas necesarias para solventar la contingencia, el InDRE realizará una auditoría 35

y/o asesoría técnica al laboratorio implicado para evaluar la competencia técnica y detectar áreas de oportunidad. c) Se enviará un tercer panel, a petición y con costo para el LESP, que nuevamente servirá para las acciones correctivas implementadas por el laboratorio. d) Si nuevamente se obtiene un resultado No aceptable se solicitará el cambio del analista para el diagnóstico de dengue en el LESP y se suspenderá inmediatamente el diagnóstico. El nuevo analista recibirá capacitación inmediata en el InDRE durante una semana, en la cual se incluirá un examen teórico y práctico al inicio y al final. e) Una vez capacitado el analista, se reanudará el diagnóstico inmediatamente. f) Derivado de los puntos anteriores y únicamente mientras dure el proceso de mejora (un mes) deberán enviar para control de calidad el 100% de positivos y el 10% de negativos de todas las muestras de probables FD y FHD. En el momento que el Laboratorio de Arbovirus y Virus Hemorrágicos lo considere pertinente y como parte de la mejora continua del PEED, la ponderación para la clasificación Sobresaliente, Satisfactorio y No aceptable, se ajustará previo aviso a la RNLSP. Se implementará la conformación de un directorio de los responsables de realizar las metodologías en cada LESP y de los suplentes, para llevar a cabo el seguimiento de los analistas, con el objetivo de detectar situaciones que pudieran impactar en el sistema de vigilancia epidemiológica por laboratorio. En caso de existir un cambio de analista, el LESP se responsabilizará de la capacitación del nuevo analista previa notificación (vía correo electrónico) al Laboratorio de Arbovirus y Virus Hemorrágico. Si este último lo considera pertinente la capacitación se realizará en las instalaciones del InDRE.

B. Los LESP que tienen una red de laboratorios locales en donde se realizan las pruebas de diagnóstico para dengue, deberán: 1. Regular las actividades de diagnóstico. 2. Supervisar la ejecución del algoritmo para el diagnóstico. 3. Implementar el PEED (a través de paneles de eficiencia). 4. Planificar supervisiones y capacitaciones en servicio. 5. Solicitar la clave de acceso al sistema de captura, plataforma única, módulo dengue, para ingresar inmediatamente los resultados generados, cumpliendo de esta forma con los tiempos establecidos para los indicadores en servicio de cada prueba realizada. C. Laboratorios de otras instituciones que requieran ingresar a la red de dengue 36

El laboratorio llevará a cabo el siguiente procedimiento: 1. Demostrar que cuentan con la infraestructura necesaria para llevar a cabo el diagnóstico (instalaciones, equipo y reactivos) durante la fase preanalítica, analítica y post-analítica. 2. Solicitar al InDRE una visita de evaluación a las instalaciones en donde se realizará el diagnóstico para supervisar las fases mencionadas anteriormente las cuales deberán cumplir con los requisitos mínimos acotados en la cédula de evaluación. 3. Si el resultado de la evaluación resulta satisfactorio continuará con el procedimiento. Pero si la evaluación indica mejorar y/o corregir el procedimiento, deberá cumplir con los siguientes puntos. a. Solicitará la capacitación y el o los analistas la recibirán durante una semana, en la cual se incluirá un examen teórico y práctico, al inicio y al final de la capacitación. b. La implementación del algoritmo para el diagnóstico deberá realizarse en un lapso no mayor a 15 días naturales después de haber recibido la capacitación. c. Como parte del proceso de control de calidad deberán enviar al InDRE el 100% de los positivos y el 10% de los negativos durante seis meses. d. Posterior a ese tiempo se enviará un primer panel de eficiencia después de la implementación (previa solicitud oficial), para evaluar el desempeño en la determinación de antígeno NS1 y anticuerpos IgM e IgG y/o RT-PCR Multiplex en tiempo real. e. Si con estos parámetros se obtiene la clasificación de Sobresaliente o Satisfactoria durante el periodo de evaluación, se suspenderá el envío de muestras para control de calidad y únicamente serán evaluados a través de paneles de eficiencia dos veces por año, durante los siguientes dos años. f. Si se obtiene un resultado No aceptable se procederá a solicitar un plan de mejora que deberán enviar al InDRE en un tiempo no mayor a una semana, se realizará una auditoría y asesoría técnica para evaluar la competencia técnica; posterior a esto se enviará un segundo panel, a petición y con costo para el laboratorio solicitante, que otra vez servirá para la evaluación del desempeño, si se obtiene de nuevo clasificación No aceptable entonces se procederá a solicitar el cambio del analista para el diagnóstico de dengue y se suspenderá inmediatamente el diagnóstico en tanto no se compruebe la competencia técnica en el laboratorio, o en su caso se evaluará si ese laboratorio puede continuar o no con la realización del diagnóstico. g. Al ingresar un nuevo analista recibirá capacitación inmediata en el InDRE durante una semana, en la cual se incluirá un examen teórico y práctico al inicio y al final de la capacitación. h. Una vez capacitado el analista, se reanudará el diagnóstico inmediatamente. i. Derivado de los puntos anteriores y únicamente mientras dure el proceso de mejora deberán enviar para control de calidad el 100% de

37

positivos y el 10% de negativos de todas las muestras de probables FD y FHD. 4. Después de evaluar el desempeño y este resulta satisfactorio pasará a la siguiente etapa para la posible liberación del diagnóstico. 5. Cuando sea necesario, al LESP de la RNLSP que le corresponda, se le darán las indicaciones pertinentes para participar y/o dar seguimiento a este proceso. 6. Todo este proceso contará con la evaluación y consideración del CONAVE. Aunado al PEED también se realizarán supervisiones a los laboratorios mediante la aplicación de una cédula estandarizada para la evaluación del proceso y así comprobar la competencia técnica, misma que deberá ser mayor del 90%. (Ver cronograma de actividades). En el momento que el SINAVE considere pertinente realizar alguna modificación en cualquiera de los puntos del PEED, se informará a la RNLSP inmediatamente. Todas las muestras enviadas en cada panel cuentan con el respaldo documentado de las características de reactividad para cada marcador. Las muestras son embaladas en condiciones óptimas para el envío a los laboratorios participantes, incluyendo instrucciones detalladas para el manejo del mismo. Cada LESP es codificado para mantener la confidencialidad de los participantes mediante una clave única. Las muestras enviadas en cada panel provienen del banco de sueros del Laboratorio de Arbovirus, el cual es sustentado con el envío programado y especificado durante sesiones vía Webex llevadas a cabo en los meses de abril y septiembre de 2012. Los paneles planificados a partir de 2013 estarán constituidos por 12 muestras de suero perfectamente caracterizados para cada marcador. Los resultados de cada panel obtenidos por cada LESP deberán ser remitidos una semana después de haber sido enviados a la cuenta del correo del Laboratorio ([email protected]). El formato de resultados impreso y firmado en original, deberá ser enviado por oficio a la Dirección General Adjunta del InDRE con atención a la Jefatura del Laboratorio y Coordinación de Enfermedades Virales Zoonóticas y por Vector. El Laboratorio de Arbovirus y Virus Hemorrágicos notificará los resultados obtenidos a cada LESP (vía correo electrónico oficialmente a cada director del LESP) una semana después de haber sido recibidos en el InDRE vía correo electrónico. Los resultados serán emitidos vía oficio en las siguientes tres semanas.

38

Seguimiento basado en proceso Con la finalidad de evaluar la reproducibilidad y repetitividad de cada método empleado, a partir del 2013, cada seis meses el InDRE solicitará a los LESP (a través de correo electrónico) el envío continuo durante una semana de los registros de proceso realizados, además de las lecturas obtenidas para cada determinación realizada. Los meses en que se realizará el seguimiento basado en proceso no serán precisados con antelación. De no recibir el InDRE la información solicitada en tiempo y forma, el LESP recibirá un primer extrañamiento, que lo obligará a brindar explicación oficial en los siguientes cinco días del motivo por el cual no envió la información solicitada.

Criterios para la liberación del diagnóstico La liberación de la metodología para realizar el diagnóstico, se basará en el cumplimiento de los siguientes criterios: 1. Obtener arriba del 99% de concordancia durante la fase de control de calidad, en al menos los últimos dos meses del periodo de alta circulación viral o de cuatro meses durante el periodo de baja endemicidad. 2. Demostrar con evidencia que se cuenta con los insumos necesarios para los siguientes 12 meses. 3. Demostrar con evidencia que se tiene el recurso humano capacitado en el área afín, y que cumple con el perfil técnico para la realización de la metodología. 4. Demostrar con evidencia que se cumple en tiempo y forma con las fases pre-analítica, analítica y post-analítica.

Si cumple con los criterios antes mencionados, se emitirá un informe a través de un oficio al LESP o institución correspondiente en el cual se manifieste el resultado de concordancia obtenida durante el proceso de Control de Calidad así como la notificación correspondiente de la fecha de liberación de la metodología. Esta notificación también se dará a conocer al CONAVE. El InDRE tiene la atribución de suspender la realización del diagnóstico en los LESP o en la institución correspondiente en cuanto detecte alguna desviación en la realización del mismo que impacte de manera significativa en el SiNaVE, esto se informará a través de un oficio al LESP correspondiente y también se notificará al CONAVE.

39

Banco de material biológico Con el objetivo de mantener el Banco de Sueros de Dengue y otras Arbovirosis con material biológico, el cual sirve para realizar los paneles, para obtener controles de referencia o para estudios que permitan implementación de nuevas técnicas de diagnóstico diferencial para otras arbovirosis cada uno de los LESP seleccionados semestralmente (información que se brindará en sesión Webex en el mes de agosto) enviará muestras los días 25 de marzo y 25 de agosto, siguiendo las siguientes especificaciones: 1. Enviar el 20% de muestras positivas y 20% de las muestras negativas para IgM, IgG y NS1. 2. Los LESP que realizan identificación de serotipos mediante RT-PCR y que cuentan con la liberación del diagnóstico, deberán enviar el 25% de muestras positivas (que incluya todos los serotipos identificados en su estado) a esta técnica y 30% de muestras negativas a RT-PCR de muestras positivas a NS1. 3. Los LESP que realizan identificación de serotipos mediante RT-PCR y que NO cuentan aún con la liberación del diagnóstico, deberán enviar el 25% de muestras positivas a esta técnica y 50% de muestras negativas para NS1. Para el envío de estas muestras se deberán usar viales de polipropileno tipo eppendorf o criotubos que deberán rotularse con el número de folio del LESP, la tapa externa deberá sellarse con papel Parafilm™, y no deberán estar contaminadas, lipémicas o hemolizadas. El volumen mínimo será de 750 µL. Es necesario indicar en el oficio de envío que se trata de material biológico para el Banco de Sueros de Dengue y otras Arbovirosis y se anexará el formato correspondiente (ver anexo) con los datos solicitados y debidamente requisitados. Por otra parte, la base electrónica se enviará al correo electrónico del Laboratorio de Arbovirus y Virus Hemorrágicos ([email protected]).

Indicaciones para la detección e identificación de serotipos de virus dengue mediante RT-PCR Multiplex en tiempo real El InDRE y los estados que cuenten con el aval, según lo indicado en puntos anteriores, realizarán la detección e identificación de serotipos circulantes de virus dengue usando métodos de biología molecular como la RT-PCR Multiplex en tiempo real, o en su defecto, aislamiento viral, como pruebas de oro. El InDRE contará con otras metodologías que le permitan actuar como un verdadero instituto de referencia. La importancia de identificar los serotipos circulantes radica en contar con la información necesaria para poder predecir posibles brotes por serotipos relacionados con cuadros clínicos graves, identificar localidades de riesgo, y

40

comprender la dinámica de transmisión, que permitan fortalecer la vigilancia virológica en el país. Si el InDRE implementa nuevas metodologías de biología molecular para la detección viral, que permitan mejorar la vigilancia virológica de dengue en México, se promoverá un curso de actualización. La CEZV-InDRE seleccionará los LESP para dichos cursos, con base en el marco analítico dado de alta y en la experiencia de los responsables del diagnóstico serológico y molecular. Esto último con la finalidad de implementar inmediatamente las nuevas metodologías en cada LESP seleccionado.

1) Laboratorios estatales que aún no realizan RT-PCR Multiplex en tiempo real para detección e identificación de serotipos de virus dengue Los LESP deberán enviar semanalmente al InDRE (para una oportuna vigilancia virológica) de manera obligatoria el 10% de las muestras positivas a NS1 para FD y el 100% de las muestras positivas a NS1 para FHD, que serán procesadas para la detección y serotipificación de virus dengue por RT-PCR Múltiplex en tiempo real. Con el objetivo de aumentar el porcentaje de tipificaciones de las muestras analizadas para este fin; las muestras positivas a NS1, deben tener entre 0-5 días de evolución, según datos reportados a nivel internacional y obtenido por la CEZVInDRE el mayor éxito en la tipificación viral está entre 0-3 días. Motivo por el cual el LESP solo debe enviar las muestras que estén en este rango de días de evolución. La solicitud del porcentaje y características de las muestras pueden variar según las necesidades del SiNaVE. Estas muestras deberán venir acompañadas con el Formato Único de Envío o cualquiera de los otros formatos previamente mencionados, debidamente requisados y un listado con los resultados obtenidos para el ensayo de antígeno NS1 en el LESP (densidad óptica de la muestra, valor de corte e interpretación de resultado y la marca del reactivo usado). El InDRE emitirá el informe de prueba y lo enviará para que cada LESP capture dentro de las siguientes 24 horas el resultado en la plataforma única, módulo dengue.

2) Laboratorios estatales que realizan RT-PCR Multiplex en tiempo real para detección e identificación de serotipos de virus dengue Control de Calidad. Los LESP que se estén incorporando al programa de control de calidad supervisado por el InDRE, trabajaran coordinadamente entre sus áreas de serología o virología y biología molecular de la siguiente manera: a) De acuerdo con el algoritmo, deberán procesar localmente las muestras para determinación de antígeno NS1 (no enviar al InDRE) y dependiendo del resultado obtenido, procesar el 10% de las muestras positivas de FD y el 100% 41

de las muestras positivas de FHD mediante RT-PCR Multiplex en tiempo real. Con el objetivo de aumentar el porcentaje de tipificación, las muestras analizadas por RT-PCR preferentemente deberán tener entre 0-3 días de evolución. Este último punto puede variar según la localidad y deberá ser aplicado acorde a los resultados analizados por el InDRE y el LESP. b) Las muestras que se envían al InDRE para control de calidad deberán tener un Ct (ciclo al threshold) menor a 32, ya que debido a la inestabilidad del ARN al cambio de temperatura puede promover pérdida y tener resultados discordantes. c) El LESP enviará al InDRE las muestras de suero junto con un listado de todos los resultados obtenidos para NS1 (densidad óptica de la muestra, valor de corte e interpretación de resultado) así como el formato de control de calidad en electrónico, el cual incluirá el resultado de RT-PCR especificando el serotipo, valor de Ct y resultados (gráficos de amplificación) de los ensayos realizados, del 100% de las muestras positivas y el 10% de las negativas durante seis meses. Este proceso se realizará hasta obtener una concordancia del 100%, la cual deberá mantenerse durante los últimos cuatro meses consecutivos para considerar la liberación de la metodología. El formato utilizado para enviar los gráficos de amplificación al InDRE fue explicado y distribuido en sesión Webex en 2012. d) En caso de no cumplir con el porcentaje de concordancia requerido para la liberación de la metodología, será necesario realizar una supervisión y asesoría técnica vía Webex o presencial tanto a las instalaciones como al personal técnico responsable de realizar la vigilancia virológica de dengue en el LESP. Todos aquellos LESP (no importando si tiene liberada la metodología) que identifiquen algún serotipo que en el transcurso de un año no ha sido identificado en su estado, (circulación sostenida durante 2 años) deberán informarlo inmediatamente a los sistemas de salud estatal y federal, y la muestra de suero y/o ARN deberá ser enviada inmediatamente al InDRE para corroborar el resultado del LESP antes de subir el resultado a la plataforma. Cualquier otra metodología diferente a la indicada y que no esté validada por el InDRE para la tipificación viral, no será considerada válida y los resultados obtenidos no serán avalados, hasta no ser enviadas al InDRE las muestras de interés.

42

Envío del primer panel Inteligente Algorítmico único a la RNLSP Recepción de resultados en el InDRE del primer panel Inteligente algorítmico único a la RNLSP Envío de resultados del primer panel Inteligente Algorítmico único a la RNLSP (e-mail oficial / físico) Envío del segundo panel Inteligente algorítmico único a la RNLSP Recepción de resultados en el InDRE segundo panel Inteligente algorítmico único a la RNLSP Envío de resultados a la RNLSP del segundo panel Inteligente algorítmico único (e-mail oficial / físico) Recepción de muestras para identificación de serotipos Supervisión a la RNLSP Envío de muestras para Banco de Sueros Envío de informe semanal de existencia de reactivos Curso de actualización Vía Webex Curso de actualización en Arbovirus

DIC

NOV

OCT

SEP

AGO

JUL

JUN

MAY

ABR

MAR

FEB

ACTIVIDAD

ENE

CRONOGRAMA DE ACTIVIDADES Este cronograma aplica para 2013. El cronograma de los años subsecuentes será enviado oportunamente vía la CEZV de la RNLSP.

XX

XX

XX

XX

XX

XX X

X

X

X

X

X

X

X

X

X

X

X

X

X

X

X

X

X

X

X

X

X

X

X

X X

X

X

X X

X

X

X

X X

X

X X

X

X X

Nota: Si alguna fecha coincide con un día no laborable, la actividad se cambia al siguiente día hábil inmediato.

Para brindar un mejor servicio, el envío y recepción de información, resultados, dudas, comentarios, asesorías técnicas, etcétera, será únicamente a través de correo electrónico: [email protected]

43

Finalmente todos los LESP deberán enviar por correo electrónico de manera semanal el informe de la existencia de reactivos para realizar diagnóstico y vigilancia virológica, al Laboratorio de Arbovirus del InDRE.

44

BIBLIOGRAFÍA 1. Halstead SB. Dengue. 2007, Lancet; 370(9599):1644-52. 2. Dussart P., Labeau B., Lagathu G., et al Evaluation of an Enzyme Immunoassay for detection of Dengue Virus NS1 Antigen in Human Serum. Clinical and Vaccine Immunology, 2006, p. 1185-1189. 3. Kumarasamy V., Chua S. K., et. al. Evaluating the sensitivity of a commercial dengue NS1 antigen-capture ELISA for early diagnosis of acute dengue virus infection. Singapoure Med. J. 2007; 48(7):669. 4. Pei-Yun S., Li-Kuang C., Shu-Fen C., et. al. Comparison of capture Immunoglobulin M (IgM) and IgG Enzyme-Linked Immunosorbent Assay (ELISA) and Nonstructural Protein NS1 Serotype-Specific IgG ELISA for Differentiation of Primary and Secondary Dengue Virus Infections. Clinical and Diagnostic Laboratory Immunology, 2003, p. 622-630. 5. Pei-Yun S., Shu-Fen C., et. al. Current Status of Dengue Diagnostics as the Center for Disease Control, Taiwan. Dengue Bulletin-Vol. 28, 2004. 6. Burke DS, Nisalak A, Ussery MA. Antibodies capture immunoassay detection of Japanese encephalitis virus immunoglobulin M and G antibodies in cerebrospinal fluid. J Clin Microbiol. 1982; 16(6):1034-42. 7. Bundo K, Igarashi A. Antibody-capture ELISA for detection of immunoglobulin M antibodies in sera from Japanese encephalitis and dengue hemorrhagic fever patients. J Virol Methods. 1985; 11(1):15-22. 8. Li-Jung Chien, Tsai-Ling Liao, Pei-Yun Shu, Jyh-Hsiung Huang, Duane J. Gubler and Gwong-Jen J. Chang. Development of Real-Time Reverse Transcriptase PCR Assays To Detect and Serotype Dengue Viruses. J Clin Microbiology. 2006; 44 (4): 1295–1304. 9. Areerat Sa-ngasang, Sasitorn Wibulwattanakij, Sumalee Chanama, et al. Evaluation of RT-PCR as a tool of diagnosis of secondary dengue virus infections. 2003. J. Infec. Dis. 56, 205-209. 10. Day-Yu Chao, Brent S. Davis, and Gwong-Jen J. Chang. Development of Multiplex Real-Time Reverse Transcriptase PCR Assays for Detecting Eight Medically Important Flaviviruses in Mosquitoes. 2007. J Clin Microbiol. 584– 589. 11. Prevention Board, Seoul: International Vaccine Institute. Accelerating Progress in Dengue Control, Dengue Diagnostics in the Americas. A PDVI publication on behalf of the Americas Dengue. 2009. 1-38. 12. Instructions for collecting, preparing and mailing specimens for dengue testing at the CDC Dengue Laboratory. 2007. 13. Dengue Guidelines for diagnosis, treatment, prevention and control. 2009. A joint publication of the World Health Organization (WHO) and the Special Programme for Research and Training in Tropical Diseases (TDR). 14. Miller MJ, et al. Guidelines for safe work practices in human and animal medical diagnostic laboratories. MMWR Surveill Summ. 6; 61:1-102; 2012. 15. Guidelines for Biosafety Laboratory Competency. MMWR. Supplement/Vol. 60; 2011. 16. World Health Organization. Guidance on regulations for the Transport of Infectious Substances 2013-2014; Geneva: WHO Press; 2012.

45

17. Chosewood C & Wilson DE. Biosafety in Microbiological and Biomedical Laboratories – 5th ed. CDC-NIH; 2009. 18. European Committee for Standardization. CWA 15793:2011 Laboratory biorisk management standard. Brussels: CEN; 2011. 19. World Health Organization. Laboratory Biosafety Manual – 3rd ed. Geneva: WHO Press; 2004.

46

ANEXOS

47

I. TÉCNICAS DIAGNÓSTICAS Y PREPARACIÓN DE REACTIVOS Serología 1. Determinación del antígeno viral NS1 del virus dengue por ELISA a. ELISA PLATELIA NS1 El estuche comercial Platelia NS1 Dengue, es un método inmunoenzimático en una etapa, tipo sándwich, en formato de microplaca de 96 pozos, útil en la detección cualitativa o semi-cuantitativa del antígeno NS1 del virus del dengue en suero o en plasma humano. La prueba utiliza anticuerpos monoclonales de ratón (AcMo) para su captura y revelación. Las muestras de pacientes y los controles son incubados directa y simultáneamente con el conjugado diluido durante 90 min a 37 °C. El antígeno NS1 presente en la muestra, formará complejos inmunes: AcMo - NS1 - AcMo - Peroxidasa. Después de los lavados practicados al final de cada incubación, la presencia del complejo inmune es revelada mediante la solución de revelado enzimático, la cual induce el desarrollo de una reacción coloreada (azul). A los 30 min de incubación a temperatura ambiente, la reacción enzimática es interrumpida mediante la adición de una solución ácida de paro. La densidad óptica obtenida a 450/620 nm es proporcional a la cantidad de antígeno NS1 presente en la muestra. La presencia del antígeno en una muestra individual se establece mediante la comparación de la densidad óptica leída en esta muestra con la obtenida en el suero del valor umbral. Equipo y material necesario:  Gabinete de bioseguridad tipo II  Baño de agua o incubadora a 37 °C  Micropipeta, 50 a 200 µL  Micropipeta multicanal de 20 a 200 µL  Espectrofotómetro  Sistema de lavado manual o automático (si se cuenta con él, en caso contrario se pueden hacer los lavados manuales utilizando una pizeta)  Puntas adecuadas para los volúmenes de cada una de las micropipetas  Gasas  Cristalería general para laboratorio  Agua bidestilada o desionizada estéril  Probeta graduada de 1000 mL  Guantes desechables  Contenedor de residuos contaminantes  Toallas de papel

48

Material proporcionado: Los siguientes reactivos vienen incluidos en el estuche comercial Platelia NS1 Dengue, el volumen utilizado de cada uno de ellos dependerá de la cantidad de sueros que se procesen. Están etiquetados con un símbolo (letra y número) para su fácil identificación. 1. Microplaca (R1) (listo para su uso): 12 tiras de 8 pozos cada una sensibilizada por AcMo anti-NS1, en bolsas herméticas al vacío. 2. Solución de lavado concentrado 10x (R2): Solución amortiguadora Tris-NaCl (pH 7.4) y 1% de Tween 20. 3. Control negativo (R3): Suero humano negativo para el antígeno NS1 Dengue. 4. Control valor de corte (R4): Suero con antígeno NS1 Dengue que contiene solución reguladora TRIS-NaCl (pH 8.0), suero albúmina bovina y glicerol. 5. Control positivo (R5): Suero con antígeno NS1 Dengue que contiene solución reguladora TRIS-NaCl (pH 8,0), suero albúmina bovina y glicerol. 6. Conjugado 50x (R6): AcMo anti-NS1 conjugado con peroxidasa. 7. Diluyente (R7): Solución reguladora que contiene Tween 20 y suero fetal de ternera. 8. TMB (R8): Solución de ácido cítrico y de acetato sódico que contiene 0.015% de H2O2 y 4% de dimetilsulfóxido (DMSO). 9. Cromógeno concentrado 11x (R9): Solución que contiene 0.25% de 3,3’, 5,5’ Tetrametilbenzidina. 10. Solución de paro (R10) (listo para su uso): Ácido sulfúrico 1N 11. Películas adhesivas

Condiciones para tomar en cuenta: a. La calidad de los resultados depende de la aplicación de las buenas prácticas de laboratorio. b. Diluir cuidadosamente los reactivos evitando su contaminación. c. No dejar secar la placa al final de los lavados y entre la distribución de los reactivos. d. No mezclar ni combinar de una misma serie de reactivos procedentes de cajas con números de lotes distintos, solo se puede utilizar la solución de lavado, el tampón de sustrato, el cromógeno y la solución de paro. e. El lavado de cada pozo es una etapa fundamental de manipulación, por lo cual se debe respetar el número de ciclos de lavado, un lavado inadecuado puede modificar los resultados finales.

49

Procedimiento analítico  Antes de realizar la detección del NS1, deberá establecerse un plan de distribución e identificación de muestras y controles, así como de los sueros problema.  Para poder validar el ensayo se utiliza un control negativo, dos valores umbrales o calibradores y un control positivo (no deberá excluirse ninguno).  Sacar el soporte y las tiras del empaque protector.  Se realiza la siguiente secuencia de colocación de los reactivos en cada uno de los pozos: 1) Agregar 50 μL de diluyente (R7) en cada pozo (color naranja). 2) Agregar 50 μL de muestras (controles y muestras problema). 3) Agregar 100 μL de conjugado diluido 1:50 a cada pozo (color verde) + 20 µL de R6 + 1.0 mL de R7 representan un volumen suficiente para 8 pozos. *Es importante que la solución de conjugado se prepare antes de comenzar a diluir los sueros. 4) Tapar la superficie con la película adhesiva. 5) Incubar la microplaca durante 90 ± 5 min a 37 ± 1 °C. 6) Diluir la solución de lavado concentrada 10x en agua bidestilada (900 mL de agua bidestilada + 100 mL de solución de lavado 10x). 7) Al finalizar la incubación, retirar la película adhesiva y verter el contenido de todos los pozos en un contenedor de residuos contaminantes que contenga hipoclorito de sodio. Lavar los pozos seis veces (lavado manual). Si el lavado es de manera automatizada, procurar verificar el equipo antes y después de su uso siguiendo las indicaciones del proveedor, terminado el último aspirado se deberá eliminar el exceso de solución de lavado sobre papel absorbente. 8) Agregar 160 µL de la solución de revelado, diluyendo 1:11 el cromógeno (R9) en solución de peróxido de hidrógeno (R8), 150 µL de R9 + 1.5 mL de R8 (volumen suficiente para 8 pozos). Dejar que la reacción se desarrolle incubando a temperatura ambiente, durante 30 ± 5 min y protegida de la luz. Los pozos con el testigo positivo, los calibradores y en aquellos donde la muestra presente antígeno NS1 Dengue, desarrollarán un color azul. *Es importante que la solución de revelado no presente coloración antes de adicionarla. 9) Agregar 100 µL de solución de paro (R10) en cada pozo. En los pozos con el control positivo, los calibradores y muestras problema que presente antígeno NS1 Dengue, el color azul cambiará a amarillo.

50

Cálculo de resultados Cálculo de valor de corte: El valor umbral corresponde a la media de las densidades ópticas de los duplicados del Control Valor de corte (R4). Cálculo de cada una de las muestras. Los resultados se obtienen con la siguiente relación: S (Densidad óptica obtenida de la muestra) CO (Valor de corte) Resultado de las muestras problema = S/CO Validación del ensayo Para validar el ensayo se deberá cumplir con los siguientes criterios: Valor de densidad óptica del valor de corte: CO = >0.2 Relación del control negativo (R3) y control positivo (R5). Relación R3 = <0.4

(Relación R3 = DOR3/CO)

Relación R5 = >1.5

(Relación R5 = DO R5/CO)

*Si no se cumple con las especificaciones anteriores, se deberá repetir el ensayo.

Interpretación de los resultados Para seguir los criterios es necesario que los resultados estén dentro de la siguiente relación: Resultado

Muestra con una relación

Negativo

< 0.5

D udoso

0.5 - 1.0

Positivo

> 1.0

Se considera No reactiva (negativa) para el antígeno NS1 del virus dengue D udosa para el antígeno NS1 del virus dengue, por lo que la muestra debe analizarse nuevamente Reactiva (positiva) para el antígeno NS1 del

virus dengue Nota: Las densidades ópticas obtenidas en las muestras altamente reactivas pueden alcanzar la densidad óptica máxima y presentarse como SOBRE

51

Reporte de resultados 1) Indicar el valor obtenido de la muestra. 2) Indicar el valor para la interpretación de los resultados. 3) Indicar la interpretación de resultados (positivo o negativo) 4) Indicar la marca del reactivo usado. b. Early ELISA NS1 El estuche comercial Dengue Early ELISA NS1, es un método inmunoenzimático tipo sándwich en formato de microplaca de 96 pozos, que se desarrolla en una etapa, útil en la detección del antígeno NS1 del virus del dengue en suero. Si el antígeno NS1 está presente en el suero, se une al anticuerpo anti-NS1 que está fijado a los pozos de poliestireno. El exceso de suero se elimina por lavado y después se agrega un segundo anticuerpo anti NS1 marcado con peroxidasa. Después de la incubación y un lavado para eliminar el exceso de reactivos, se adiciona el sistema sustrato-cromógeno (TMB-peróxido de hidrógeno). La reacción se interrumpe al adicionar la solución ácida de paro, por lo que la solución final de color amarillo indica la presencia de antígeno.

Equipo y material necesario:              

Gabinete de bioseguridad tipo II Baño de agua o incubadora a 37 °C Micropipeta de 50 a 200 µL Micropipeta multicanal de 20 a 200 µL Espectrofotómetro Sistema de lavado manual o automático (si se cuenta con él, en caso contrario se pueden hacer los lavados manuales utilizando pizeta) Puntas adecuadas para los volúmenes de cada una de las micropipetas Gasas Cristalería general para laboratorio Agua bidestilada o desionizada estéril Probeta graduada de 1000 mL Guantes desechables Contenedor de residuos contaminantes Toallas de papel

Material proporcionado: Los siguientes reactivos están incluidos en el estuche comercial Dengue Early ELISA NS1 (E-DEN02P), el volumen utilizado de cada uno de ellos dependerá de la cantidad de sueros que se procesen.

52

1. Micropozos en tiras de 8 pozos cada una, sensibilizados con anticuerpo antiNS1, listos para su uso. 2. Conjugado anticuerpo monoclonal Anti-NS1-peroxidasa: Frasco (color naranja) de 15 mL, listo para su uso. Estable a 2-8 °C hasta la fecha de caducidad. 3. Solución de lavado (20x). Frasco de 60 mL con solución amortiguadora de fosfatos (pH 7.2-7.6) con Tween 20 y conservador. Diluir una parte de solución en 19 partes de agua destilada, esta solución es estable por una semana a 2-25 °C. 4. Diluyente de la muestra: Frasco (color café) con 22 mL de solución amortiguadora tris-salina (pH 7.2-7.6), listo para su uso y estable a 2-8 °C hasta la fecha de caducidad. 5. Solución cromógeno TMB: Frasco de 15 mL con una mezcla de 3,3’, 5,5’tetrametilbenzidina y peróxido de hidrógeno en solución amortiguadora de citratos (pH 3.5-3.8). Estable a 2-8 °C hasta la fecha de caducidad. 6. Control positivo: Vial de tapón morado con 1.2 mL de antígeno NS1 Dengue recombinante. Estable a 2-8 °C hasta la fecha de caducidad. 7. Calibrador: 2 viales de tapón naranja con 1.5 mL de antígeno recombinante. Estable a 2-8 °C hasta fecha de caducidad. 8. Control negativo: Vial de tapón blanco con 1.2 mL de suero humano. Estable a 2-8 °C hasta fecha de caducidad. 9. Solución de paro: Frasco de tapón rojo, listo para su uso. Ácido fosfórico 1M. Estable a 2-25 °C hasta la fecha de caducidad. Condiciones para tomar en cuenta: a. Esta prueba usa solamente suero humano. No se ha establecido el uso de otro fluido biológico como plasma o sangre completa. b. No utilizar muestras con hemólisis, lipémica o contaminadas. c. No inactivar los sueros. d. Diluir cuidadosamente los reactivos evitando su contaminación. e. No dejar secar la placa al final de los lavados y entre la distribución de los reactivos. f. Los pozos sin usar pueden conservarse cubiertos en presencia de desecante. g. Evitar la exposición de la luz directa ya que puede afectar el sistema de sustrato cromógeno.

53

Procedimiento general  Antes de realizar la detección de NS1, deberá establecerse un plan de distribución e identificación de muestras y controles, así como de los sueros problema.  Dejar a temperatura ambiente (20-25 °C) los reactivos incluidos en el estuche. Dilución de la muestra y controles 1) Retirar del estuche el número de tiras con micropozos a utilizar y colocarlas en los marcos. Se requieren 5 pozos para el control positivo (P), el control negativo (N) y el calibrador por triplicado (C). 2) Utilizar tubos para dilución del control positivo, control negativo, calibrador y muestras de pacientes, adicionar 75 µL de solución del control positivo, control negativo, calibrador y muestras de pacientes, y también 75 µL de suero y 75 µL de diluyente de muestra. Mezclar bien, la dilución final es 1:2. 3) No mezclar los controles por agitación mecánica ya que contienen glicerol, solo mezclar por inmersión. ELISA 1. 2. 3. 4. 5. 6. 7. 8. 9. 10.

Agregar 100 µL de las respectivas diluciones de los controles, calibradores y muestras problema a los pozos de reacción. Cubrir la placa e incubar durante 1 hora a 37 °C. Lavar seis veces con la solución de lavado y aspirar el líquido (lavado automatizado). Agregar 100 µL del conjugado anti-NS1-peroxidasa a cada pozo. Cubrir la placa e incubar durante 1 hora a 37 °C. Lavar seis veces con la solución de lavado y aspirar el líquido (lavado automatizado). Agregar 100 µL de solución TMB en cada pozo. Incubar por 10 min a temperatura ambiente (20-25 °C). Se desarrollará una coloración azul. Agregar 100 µL de la solución de paro a cada pozo. Mezclar bien. La solución cambiará a color amarillo. Leer la absorbancia de cada pozo a 450 nm utilizando un filtro de referencia de 600-650 nm.

Nota: Si el espectrofotómetro utilizado no cuenta con filtro dual o de referencia (600-650 nm) pueden obtenerse valores de absorbancia elevados.

54

Lavado automatizado 1. Aspirar completamente el volumen de cada pozo. 2. Llenar los pozos con un volumen máximo de 350 µL durante un ciclo de lavado. 3. Deberán completarse seis ciclos de lavado. Una vez terminados estos, eliminar el exceso de solución de lavado utilizando un papel absorbente, invirtiendo la placa sobre este. 4. El lavador de placas deberá tener mantenimiento frecuente para asegurar un lavado eficiente. Cada equipo tiene sus instrucciones de limpieza y mantenimiento. Cálculos para validación del ensayo 1. Calcular el promedio de las absorbancias obtenidas en los calibradores y multiplicar por el factor de calibración. Este será el valor de corte. 2. Se puede calcular el valor índice de cada muestra, dividiendo la absorbancia de la muestra entre el promedio de las absorbancias del calibrador. Alternativamente: 3. Las unidades Panbio pueden ser calculadas multiplicando por 10 los valores obtenidos durante el paso 2. Valor índice= Absorbancia de la muestra/valor de corte. Ejemplo: Absorbancia de la muestra A = 0.949 Absorbancia de la muestra B = 0.070 Promedio de absorbancias del calibrador = 0.802 Factor de calibración = 0.62 Valor de corte = 0.802 x 0.62 = 0.497 Muestra A = (0.949/0.497) = 1.91 Valor índice Muestra B = (0.070=0.032) = 0.14 Valor índice Unidades Panbio = Valor índice X 10 Muestra A = 1.91 X 10 = 19.1 Unidades Panbio Muestra B = 0.14 X 10 = 1.4 Unidades Panbio

55

Interpretación de los resultados Índice

Unidades Panbio

Resultado

Interpretación

Negativo

No existe antígeno NS1 detectable. Si la muestra es negativa y aún se sospecha de la enfermedad, se deberá tomar una siguiente muestra antes de los 14 días de haberse tomado la inicial y ensayarla para determinación de antígeno.

9–11

Indeterminado

Repetir la muestra

<11

Positivo

Indica presencia de antígeno NS1

<0.9

<9

0.9–1.1 <1.1

Reporte de resultados 1) 2) 3) 4)

Indicar el valor obtenido de la muestra (en unidades). Indicar el valor para la interpretación de los resultados. Indicar la interpretación de resultados (positivo y/o negativo) Indicar la marca del reactivo usado.

2. Determinación de anticuerpos IgM por ELISA Cuando los anticuerpos de la clase IgM están presentes durante una infección por virus del dengue, se combinan con anticuerpos anti-IgM que se encuentran adheridos en la superficie de los pozos de la placa de poliestireno. Una mezcla de los cuatro serotipos del virus del dengue es usada para llevar a cabo la reacción antígeno-anticuerpo. Los antígenos son producidos usando un sistema de expresión en células de insecto (recombinantes), inmunopurificados utilizando anticuerpos monoclonales específicos. Un volumen igual de anticuerpos monoclonales (Mab) conjugados con Horseradish peroxidase (HRP, por sus siglas en inglés, Peroxidasa de rábano) es adicionado permitiendo que se formen complejos antígeno-Mab/conjugado. El suero residual es removido por lavados con solución amortiguadora de fosfatos y el complejo antígeno-Mab es adicionado a la placa. Después de la incubación los pozos son lavados y un sistema incoloro de tetrametilbencidina/peróxido de hidrógeno (TMB/H2O2) es adicionado. El sustrato es hidrolizado por la enzima y el cromógeno cambia a un color azul. Después la reacción es interrumpida con solución ácida de paro y el TMB cambia de color azul a amarillo. El color desarrollado es indicativo de la presencia de anticuerpos antivirus del dengue en la muestra de suero problema.

56

Material proporcionado: 1. Microplacas de 96 pozos con anti-IgM humana adherida (placa de ensayo). Los pozos que no se utilicen deberán ser almacenados con el desecante inmediatamente. Es estable de 2-8 °C hasta la fecha de caducidad. 2. Antígenos del virus del dengue de los cuatro serotipos (recombinantes), 150 µL de la mezcla de antígenos (color azul). El antígeno diluido que no se utilizará deberá ser descartado. El antígeno concentrado es estable de 2-8 °C hasta la fecha de caducidad. 3. Solución amortiguadora de fosfatos para lavado. Un frasco con 60 mL de solución de lavado concentrada 20x (pH 7.2-7.6) con Tween 20 y conservador (0.1% de ProclinTM). La cristalización de sales puede ocurrir a temperaturas más bajas de lo indicado para su almacenamiento, incubar a 37 °C hasta disgregar los cristales. Diluir una parte de la solución concentrada con 19 partes de agua bidestilada. La solución diluida puede ser almacenada por una semana a temperatura ambiente (20-25 °C). 4. Diluyente de muestra problema, testigos y calibrador. Dos frascos (color rosa) con 50 mL cada uno. Listo para su uso. La solución tiene un pH de 7.27.6 con conservador (0.1% de ProclinTM) y aditivos. Es estable de 2-8 °C hasta la fecha de caducidad. 5. Diluyente de antígeno. Un frasco (incoloro) con 50 mL. Listo para su uso. La solución amortiguadora de fosfatos que contiene esta solución contiene conservadores (0.1% de ProclinTM y 0.005% de gentamicina). 6. Anticuerpo monoclonal conjugado a HRP. Un frasco (color amarillo) con 7.0 mL. Listo para su uso, “Horseradish peroxidase” (HRP) con conservador (0.1% de ProclinTM) y estabilizadores de proteína. Estable de 2-8 °C hasta la fecha de caducidad. 7. Tetrametilbenzidina (TMB). Un frasco de 15 mL. Listo para su uso. Una mezcla de 3,3´, 5,5´-tetrametilbenzidina y peróxido de hidrógeno en una solución amortiguadora de citratos (pH 3.5-3.8). Estable de 2-8 °C hasta la fecha de caducidad. 8. Suero control positivo para IgM. Un vial con tapón de color negro, 200 µL de suero humano (contiene 0.1% de azida de sodio y 0.005% de sulfato de gentamicina). Estable de 2-8 °C hasta la fecha de caducidad. 9. Suero calibrador (valor de corte) para IgM. Un vial con tapón de color naranja, 400 µL de suero humano (contiene 0.1% de azida de sodio y 0.005% de sulfato de gentamicina). Estable de 2-8 °C hasta la fecha de caducidad. 10. Suero control negativo para IgM. Un vial con tapón de color blanco, 200 µL de suero humano (contiene 0.1% de azida de sodio y 0.005% de sulfato de gentamicina). Estable de 2-8 °C hasta la fecha de caducidad. 11. Solución de paro. Un frasco con 15 mL. Listo para su uso. Ácido fosfórico 1M. Estable de 2-8 °C hasta la fecha de caducidad. Los controles y calibradores contienen azida de sodio, la cual es clasificada como de extremo cuidado al manejarla. El contacto con ácidos libera gases muy tóxicos, por lo cual debe manejarse con precaución.

57

Equipo y material necesario:          

Gabinete de bioseguridad tipo II Micropipetas de volumen variable con puntas con capacidad de 5-1000 µL Agua bidestilada Sistema de lavado automático para microplacas Lector de placas con filtros de 450 y 620 nm Cronómetro Probetas Matraces Tubos dilutores Tubos de vidrio o plástico para diluir el antígeno

Condiciones para tomar en cuenta: a. Esta prueba deberá ser utilizada únicamente en muestras de suero. El uso de sangre completa, plasma u otro tipo de muestra aún no ha sido establecido para su análisis. b. Muestras de suero ictéricas, lipémicas o hemolizadas o con crecimiento bacteriano y fúngico (contaminadas) no deberán ser analizadas. c. No inactivar los sueros mediante calentamiento. d. El ensayo estará afectado por los cambios de temperatura, por lo que todos los reactivos deberán llevarse a temperatura ambiente (20-25 °C) antes de comenzar el ensayo. No remover la microplaca de la bolsa cerrada de almacenamiento hasta que se haya atemperado. e. Agregar los reactivos directamente de los frascos usando pipetas limpias y estériles. La transferencia de los reactivos puede provocar contaminación. La bolsa de almacenamiento en la presencia del desecante. Si no se tiene el cuidado, esto puede provocar errores en los resultados.

a. b. c. d. e.

f.

Recomendaciones para el uso del Sistema Sustrato: Como el TMB es fácilmente susceptible a contaminación por iones metálicos, no deberá permitirse que el sistema sustrato tenga contacto con superficies metálicas. Nunca se deberá permitir la exposición prolongada a la luz directa. Algunos detergentes pueden interferir en la actividad del TMB. El TMB puede presentar un ligero color azul. Esto no afectará la actividad del sustrato o los resultados del ensayo. Peligro. Algunos componentes contienen azida de sodio, la cual puede reaccionar formando componentes metálicos de azida que pueden ser explosivos. Para desechar este reactivo deberá seguirse las indicaciones para el manejo de reactivos químicos peligrosos. La azida de sodio inhibe la actividad del conjugado. Deberán usarse puntas limpias y estériles para cada reactivo.

58

Procedimiento general Dilución del suero 1) Remover las tiras de pozos que serán utilizados e insertarlos en la base. Serán requeridos cinco pozos para controles y calibradores. Asegurar que los pozos que no se utilicen sean incorporados en la bolsa de almacenamiento que contendrá el desecante. 2) Usando tubos especiales para dilución de sueros, comenzar a diluir los testigos negativo (N) y positivo (P), los calibradores por triplicado y las muestras problema. Para la dilución de la muestra se pueden seguir dos alternativas: a) Adicionar 1000 µL de diluyente (color rosa) a los viales dilutores y adicionarle 10 µL de suero. Mezclar bien. b) Adicionar 90 µL de diluyente y adicionar 10 µL de suero. Tomar 20 µL de la dilución anterior y adicionar 180 µL del diluyente. Mezclar bien. ELISA Antígeno 1) Determinar el número requerido de tiras para el ensayo de acuerdo con el número de muestras problema y controles. Diluir el antígeno 1:250 usando la solución diluyente de antígeno, esta dilución es recomendada como la dilución mínima ya que necesita 10 µL de antígeno concentrado diluido en 2.5 mL de diluyente de antígeno. Este volumen es suficiente para 40 pozos. Un volumen de 0.5 mL de antígeno diluido es necesario para una tira. Una vez que el antígeno es adicionado al diluyente de antígeno, la solución se torna de color azul claro. Asegurarse que el antígeno concentrado que no se ocupará se almacene en refrigeración (2-4 °C). 2) Remover el volumen requerido de antígeno diluido y mezclar bien con un volumen igual de anticuerpo monoclonal conjugado de peroxidasa (Mab Tracer) en un frasco limpio y estéril. Dejar a temperatura ambiente hasta que se requiera. Descartar el antígeno diluido que no se utilizará. 3) En de los siguientes 10 min después de mezclar el Mab Tracer y el antígeno diluido, agregar 100 µL de muestra problema, de los testigos y de los calibradores dentro de sus respectivos pozos de la placa de ensayo. 4) Cubrir la placa e incubar por 1 hora a 37 °C. 5) Lavar seis veces con solución de lavado diluida. 6) Agitar la solución de antígeno–Mab antes de transferir la solución a los pozos. Agregar 100 µL del complejo antígeno–Mab a cada pozo. 7) Cubrir la placa e incubar por 1 hora a 37 °C. 8) Lavar seis veces con solución de lavado diluida. 9) Agregar 100 µL de TMB a cada pozo.

59

10) Incubar por 10 min a temperatura ambiente, procurando tomar el tiempo desde el primer pozo o tira de pozos. Aparecerá un color azul en el testigo positivo, los calibradores y las muestras positivas. 11) Agregar 100 µL de solución de paro a cada pozo en la misma secuencia en la que se agregó el TMB. El color azul cambiará a amarillo. 12) En de los siguientes 30 min leer la absorbancia de cada testigo, calibrador y muestras a una longitud de onda dual de 450 nm con filtro de referencia de 600-650 nm. Nota: Si el espectrofotómetro utilizado no cuenta con filtro dual o de referencia (600-650 nm) puede provocar valores de absorbancia elevados.

Lavado automatizado 1. Aspirar completamente el volumen de cada pozo. 2. Llenar los pozos con un volumen máximo de 350 µL durante un ciclo de lavado. 3. Deberán completarse seis ciclos de lavado. Una vez terminados estos, eliminar el exceso de solución de lavado utilizando un papel absorbente, invirtiendo la placa sobre este. 4. El lavador de placas deberá tener mantenimiento frecuente para asegurar un lavado eficiente. Cada lavador tiene sus instrucciones de limpieza y mantenimiento. Cálculos para validación del ensayo 1. Calcular el promedio de las absorbancias obtenidas en los calibradores. Este será el valor de corte. 2. Se puede calcular el valor índice de cada muestra, dividiendo la absorbancia de la muestra entre el promedio de las absorbancias del calibrador. Alternativamente: 3. Las unidades Panbio pueden ser calculadas multiplicando por 10 los valores obtenidos durante el paso 2. Valor índice = Absorbancia de la muestra/valor de corte. Ejemplo: Absorbancia de la muestra A = 0.949 Absorbancia de la muestra B = 0.070 Valor de corte = 0.302 Muestra A = (0.949/0.302) = 3.14 Valor índice Muestra B = (0.070=0.032) = 0.23 Valor índice Unidades Panbio = Valor índice X 10 Muestra A = 3.14 X 10 = 31.4 Unidades Panbio Muestra B = 0.23 X 10 = 2.3 Unidades Panbio

60

Interpretación de resultados Índice

Unidades Panbio

<0.9

<9

0.9–1.1

9-11

<1.1

<11

Resultado

Interpretación

Negativo

No existen anticuerpos IgM detectables. Si la muestra fue tomada durante la fase aguda es necesaria otra toma a los 7-14 días de iniciados los síntomas.

Indeterminado Repetir la muestra Positivo

Indica presencia de anticuerpos

Reporte de resultados 1. 2. 3. 4.

Indicar el valor obtenido de la muestra (en unidades). Indicar el valor para la interpretación de los resultados. Indicar la interpretación de resultados (positivo o negativo). Indicar la marca del reactivo usado.

3. Determinación de anticuerpos IgG por ELISA (identificación de reinfecciones) Cuando los anticuerpos de la clase IgG están presentes durante una reinfección por virus del dengue, se combinan con anticuerpos anti-IgG que se encuentran adheridos en la superficie de los pozos de la placa de poliestireno. Una solución que reconstituye la mezcla de los cuatro serotipos del virus de dengue liofilizado, es usada para llevar a cabo la reacción antígeno-anticuerpo. Un volumen igual de anticuerpos monoclonales (Mab) conjugados con HRP es adicionado permitiendo que se formen complejos antígeno-Mab/conjugado. El suero residual es removido por lavados con solución amortiguadora de fosfatos y el complejo antígeno-Mab es adicionado a la placa. Después de la incubación los pozos son lavados y un sistema incoloro de tetrametilbencidina/peróxido de hidrogeno (TMB/H2O2) es añadido. El sustrato es hidrolizado por la enzima y el cromógeno cambia a un color azul. Después la reacción es interrumpida con solución ácida de paro y el TMB cambia de color azul a amarillo. El color desarrollado es indicativo de la presencia de anticuerpos anti-virus del dengue en la muestra de suero problema. Material proporcionado: 1. Microplacas de 96 pozos con anti-IgG humana adherida (placa de ensayo). Los pozos que no se utilicen deberán ser almacenados con el desecante inmediatamente. Es estable de 2-8 °C hasta la fecha de caducidad. 2. Viales con antígeno liofilizado y estabilizado Dengue, cuatro serotipos. El antígeno reconstituido que no se ocupe puede ser congelado a -20 °C o

61

menos. El antígeno liofilizado es estable de 2-8 °C hasta la fecha de caducidad. 3. Solución amortiguadora de fosfatos para lavado. Un frasco con 60 mL de solución de lavado concentrada 20x (pH 7.2-7.6) con Tween 20 y conservador (0.1% de ProclinTM). La cristalización de sales puede ocurrir a temperaturas más bajas de lo indicado para su almacenamiento, incubar a 37 °C hasta disgregar los cristales. Diluir una parte de la solución concentrada con 19 partes de agua bidestilada. La solución diluida puede ser almacenada por una semana a temperatura ambiente (20-25 °C). 4. Diluyente de muestra problema, testigos y calibrador. Dos frascos (color rosa) de 50 mL cada uno. Listo para su uso. La solución tiene un pH de 7.27.6 con conservador (0.1% de ProclinTM) y aditivos. Es estable de 2-8 °C hasta la fecha de caducidad. 5. Reconstituyente de antígeno. Un frasco (incoloro) con 7.0 mL. Listo para su uso. La solución amortiguadora que contiene esta solución tiene conservadores (0.1% de ProclinTM). Estable de 2-8 °C hasta la fecha de caducidad. 6. Anticuerpo monoclonal conjugado a peroxidasa de rábano (HRP). Un frasco (color verde) de peroxidasa de rábano (HRP) con 7.0 mL, listo para usarse, con conservador (0.1% de ProclinTM) y estabilizadores de proteína. Estable de 2-8° C hasta la fecha de caducidad. 7. Tetrametilbenzidina (TMB). Un frasco de 15 mL. Listo para su uso. Una mezcla de 3,3´, 5,5´- tetrametilbenzidina y peróxido de hidrógeno en una solución amortiguadora de citratos (pH 3.5-3.8). Estable de 2-8° C hasta la fecha de caducidad. 8. Suero control positivo para IgG. Un vial con tapón de color rojo, 200 µL de suero humano (contiene 0.1% de azida de sodio y 0.005% de sulfato de gentamicina). Estable de 2-8 °C hasta la fecha de caducidad. 9. Suero calibrador (valor de corte) para IgG. Un vial con tapón de color amarillo, 400 µL de suero humano (contiene 0.1% de azida de sodio y 0.005% de sulfato de gentamicina). Estable de 2-8 °C hasta la fecha de caducidad. 10. Suero control negativo para IgG. Un vial con tapón de color blanco, 200 µL de suero humano (contiene 0.1% de azida de sodio y 0.005% de sulfato de gentamicina). Estable de 2-8 °C hasta la fecha de caducidad. 11. Solución de paro. Un frasco con 15 mL. Listo para su uso. Ácido fosfórico 1M. Estable de 2-25 °C hasta la fecha de caducidad. Los controles y calibradores contienen azida de sodio, la cual es clasificada como de extremo cuidado al manejarla. El contacto con ácidos libera gases muy tóxicos, debe manejarse con precaución. Equipo y material necesario  

Micropipetas de volumen variable con puntas con capacidad de 5-1000 µL Agua bidestilada 62

      

Sistema de lavado automático para microplacas Lector de placas con filtros de 450 y 620 nm Cronómetro Probetas Matraces Tubos dilutores Tubos de vidrio o plástico para diluir el antígeno

Condiciones para tomar en cuenta a) Esta prueba deberá ser utilizada únicamente en muestras de suero. El uso de sangre completa, plasma u otro tipo de muestra aún no ha sido establecido para su análisis. b) Muestras de suero ictéricas, lipémicas, hemolizadas o con crecimiento bacteriano y fúngico (contaminadas) no deberán ser analizadas. c) No inactivar los sueros mediante calentamiento. d) El ensayo estará afectado por los cambios de temperatura, por lo que todos los reactivos deberán llevarse a temperatura ambiente (20-25 °C) antes de comenzar el ensayo. No remover la microplaca de la bolsa cerrada de almacenamiento hasta que se haya atemperado. Recomendaciones para el uso del Sistema Sustrato: a) Como el TMB es fácilmente susceptible a contaminación por iones metálicos, no deberá permitirse que el sistema sustrato tenga contacto con superficies metálicas. b) Nunca se deberá permitir la exposición prolongada a la luz directa. c) Algunos detergentes pueden interferir en la actividad del TMB. d) El TMB puede presentar un ligero color azul. Esto no afectará la actividad del sustrato o los resultados del ensayo. e) Peligro. Algunos componentes contienen azida de sodio, la cual puede reaccionar formando componentes metálicos de azida, que pueden ser explosivos. Para desechar este reactivo deberá seguir las indicaciones para el desecho de reactivos químicos peligrosos. f) La azida de sodio, inhibe la actividad del conjugado. Deberán usarse puntas limpias y estériles para cada reactivo.

Procedimiento general Dilución del suero  Remover las tiras de los pozos que serán utilizados e insertarlos en la base. Serán requeridos cinco pozos para controles y calibradores. Asegurar que los pozos que no se utilicen sean incorporados en la bolsa de almacenamiento que contendrá el desecante.

63



Usando tubos especiales para dilución de sueros, comenzar a diluir los testigos negativo (N) y positivo (P), los calibradores por triplicado y las muestras problema. Para la dilución de la muestra se pueden seguir dos alternativas: a) Adicionar 1000 µL de diluyente (color rosa) a los viales dilutores y adicionar 10 µL de suero. Mezclar bien. b) Agregar 90 µL de diluyente y adicionar 10 µL de suero. Tomar 20 µL de la dilución anterior y adicionar 180 µL del diluyente. Mezclar bien.

ELISA Viales con antígeno estabilizado  Determinar el número requerido de tiras para el ensayo de acuerdo con el número de muestras problema y controles. Remover el número de viales de antígeno liofilizado. Cada vial es suficiente para 16 pozos. Reconstituir cada vial con 1.0 mL de solución para reconstituir antígeno liofilizado. El antígeno reconstituido que no se ocupe deberá mantenerse en congelación a -20 °C o menos. Asegurarse que los viales de antígeno no reconstituido que no se ocuparán se almacenen en refrigeración (2-4 °C).

2)

3) 4) 5) 6) 7) 8) 9) 10) 11) 12)

1) Remover el volumen requerido de antígeno reconstituido y mezclar bien con un volumen igual de anticuerpo monoclonal conjugado de peroxidasa (Mab Tracer) en un frasco limpio y estéril. Dejar a temperatura ambiente hasta que se requiera. En de los siguientes 10 min después de mezclar el Mab Tracer y el antígeno reconstituido, agregar 100 µL de muestra problema, de los testigos y de los calibradores (todos diluidos 1:100) dentro de sus respectivos pozos de la placa de ensayo. Cubrir la placa e incubar por 1 hora a 37 °C. Lavar seis veces con solución de lavado diluida. Agitar la solución de antígeno– Mab antes de transferir la solución a los pozos. Agregar 100 µL del complejo antígeno– Mab a cada pozo. Cubrir la placa e incubar por 1 hora a 37 °C. Lavar seis veces con solución de lavado diluida. Agregar 100 µL de TMB a cada pozo. Incubar por 10 min a temperatura ambiente, procurando tomar el tiempo desde el primer pozo o tira de pozos. Aparecerá un color azul en el testigo positivo, los calibradores y en las muestras positivas. Agregar 100 µL de solución de paro a cada pozo en la misma secuencia en la que agregó el TMB. El color azul cambiará a amarillo. En de los siguientes 30 min leer la absorbancia de cada testigo, calibrador y muestras a una longitud de onda dual de 450 nm con filtro de referencia de 600-650 nm.

Nota: Si el espectrofotómetro utilizado no cuenta con filtro dual o de referencia (600-650 nm) puede provocar valores de absorbancia elevados.

64

Lavado Automatizado 1. Aspirar completamente el volumen de cada pozo. 2. Llenar los pozos con un volumen máximo de 350 µL durante un ciclo de lavado. 3. Deberán completarse seis ciclos de lavado. Una vez terminados estos, eliminar el exceso de solución de lavado utilizando un papel absorbente, invirtiendo la placa sobre este. 4. El lavador de placas deberá tener mantenimiento frecuente para asegurar un lavado eficiente. Cada lavador tiene sus instrucciones de limpieza y mantenimiento. Cálculos para validación del ensayo 1. Calcular el promedio de las absorbancias obtenidas de los calibradores. Este será el valor de corte. 2. Se puede calcular el valor índice de cada muestra, dividiendo la absorbancia de la muestra entre el promedio de las absorbancias del calibrador. Alternativamente: 3. Las unidades Panbio pueden ser calculadas multiplicando por 10 los valores obtenidos durante el paso 2. Valor índice = Absorbancia de la muestra/valor de corte. Ejemplo: Absorbancia de la muestra A = 0.949 Absorbancia de la muestra B = 0.070 Valor de corte = 0.302 Muestra A = (0.949/0.302) = 3.14 Valor índice Muestra B = (0.070=0.032) = 0.23 Valor índice Unidades Panbio = Valor índice X 10 Muestra A = 3.14 X 10 = 31.4 Unidades Panbio Muestra B = 0.23 X 10 = 2.3 Unidades Panbio

65

Interpretación de resultados Índice

Unidades Panbio

<1.8

<18

1.8–2.2

1.8–2.2

<2.2

<22

Resultado

Interpretación

Negativo

No existen anticuerpos IgG detectables. Si la muestra tiene unidades Panbio menores de 18, se puede recurrir a realizar la detección de anticuerpos tipo IgM con E-DEN01, para la detección de infecciones primarias

Indeterminado Repetir la muestra Positivo

Indica presencia de anticuerpos IgG de una infección secundaria

Reporte de resultados 1. 2. 3. 4.

Indicar el valor obtenido de la muestra (en unidades) Indicar el valor para la interpretación de los resultados Indicar la interpretación de resultados (positivo o negativo) Indicar la marca del reactivo usado

Biología molecular 1. Detección e identificación de serotipos del virus dengue mediante RT-PCR Multiplex en tiempo real Fundamento La RT-PCR Multiplex en tiempo real, es un ensayo que tiene la capacidad de monitorear en cada ciclo el progreso de la amplificación de material genético. Los datos son colectados desde el primer ciclo de reacción hasta el último, permitiendo realizar cuantificación relativa y absoluta de la carga viral presente en la muestra. La detección de la amplificación de una secuencia específica es monitoreada mediante la captación de señales de fluorescencia emitida durante los ciclos de la PCR. La presencia de altas concentraciones de ARN o de número de copias de material genético evidenciará un incremento en la fluorescencia en los primeros ciclos de la reacción. Por el contrario, bajas concentraciones de ARN permitirán obtener un incremento de fluorescencia en los últimos ciclos de la reacción. Este método está basado en la técnica desarrollada por Jeff Chang y cols. 2006. El virus dengue, se encuentra en circulación en concentraciones detectables durante la fase aguda de la enfermedad (0-5 días) y esta característica hace que este ensayo sea utilizado únicamente durante esta fase y en muestras con resultados positivos a antígeno NS1.

66

Tipo de muestras que se pueden usar Debe usarse únicamente en muestras de suero, plasma o fluidos libres de células, otra muestra diferente deberá ser evaluada así como su ensayo de extracción específico. Actualmente muestras de moscos y clarificado de moscos pueden ser utilizadas para la vigilancia entomo-virológica. El uso de sangre completa u otro tipo de muestra no ha sido establecido aún para su análisis. El envío de ARN de los LESP al InDRE quedará sujeto a evaluación por el Laboratorio de Arbovirus según necesidades identificadas; falta de muestra de suero, de plasma, de mosco y otros. Controles positivos certificados Cada una de las cepas tipo de los cuatro diferentes serotipos del virus dengue; DENV-1 (HAWÁI), DENV-2 (NUEVA GUINEA), DENV-3 (H-87 o PR-6) y DENV-4 (H-241) se inocularon en monocapa confluente al 90% de células C6-36 (donadas por el CDC, Dengue Branch, de San Juan, Puerto Rico). El medio de cultivo MEM (Medio Mínimo Esencial) para mantenimiento es suplementado con 1% de vitaminas, 1% de aminoácidos no esenciales, 1% de L-glutamina y 2% de suero fetal de ternera (SFT). Los serotipos de estos cultivos de virus tipo, fueron demostrados, realizando inmunofluorescencia indirecta mediante la utilización de anticuerpos monoclonales serotipo específicos (Donados por CDC Dengue Branch, San Juan, Puerto Rico y producidos en CDC de Fort Collins, Colorado). Las cepas son cosechadas a los 6-7 días para DENV-2 y DENV-3 y a los 9 días para DENV-1 y DENV-4. Son enriquecidas con 10% de SFT para criopreservar y posteriormente son almacenadas a -80 °C, hasta su uso. Cada vez que lo soliciten, estas cepas son enviadas a los LESP que realizan la vigilancia virológica para ser usados como controles positivos en sus ensayos. A partir del segundo semestre de 2012 estas cepas serán enviadas con su certificado de análisis (secuenciación, IFI y RT-PCR con blanco de amplificación en regiones diferentes del genoma). Actualmente ya existen casas comerciales que fabrican controles cuantificables y que sirven como controles internos de proceso de extracción y de amplificación, estos serán recomendados por el InDRE únicamente previa evaluación. Conservación de las muestras 

Los sueros de fase aguda de pacientes con sintomatología compatible a dengue, y clarificados de moscos, se deberán conservar en refrigeración (4-6 °C) desde la toma o colecta hasta el envío y recepción a los LESP o al Laboratorio de Arbovirus del InDRE.



Los clarificados de mosquitos se obtendrán del macerado de máximo 35 especímenes, con mortero o macerador automático, en 0.5-2.0 mL de medio MEM enriquecido con Suero Fetal de Ternera (SFT) al 10% y 0.1% de penicilina/estreptomicina.



El producto del macerado deberá centrifugarse entre 2500 y 10 000 rpm a 4 °C para obtener un clarificado, el cual será utilizado para extracción de ARN.

67



El clarificado restante deberá separarse en alícuotas de 500 µL que se almacenan a -70 °C.



Estas muestras serán analizadas según el algoritmo: muestras de humano con resultado positivo a antígeno NS1 y los clarificados de moscos para vigilancia entomo-virológica, se les realizará extracción de ARN mediante el método manual (QIAGEN) o automatizado (ROCHE MagNA Pure LC 2.0). Una vez extraído y purificado el ARN, se almacenará a -20 °C si se amplifica en la siguiente semana o a -70 °C si se amplifica después de 8 días o más.

Equipo necesario: 1)       

Área de extracción Gabinete de Bioseguridad tipo A2, Clase II Microcentrífuga Refrigerador Congelador (-20 °C) Micropipeta de volumen variable entre 10-100 µL Micropipeta de volumen variable entre 20-200 µL Micropipeta de volumen variable entre 100-1000 µL

2)        

Área de preparación de la mezcla maestra de reacción Gabinete de bioseguridad para PCR Microcentrífuga Minispin Agitador tipo vortex Micropipeta de volumen variable entre 0.5-10 µL Micropipeta de volumen variable entre 20-200 µL Micropipeta de volumen variable entre 100-1000 µL Micropipeta de volumen variable entre 100-1000 µL

3)    

Área de adición de ARN de muestras problemas Estación de trabajo con Flujo Laminar Microcentrífuga Minispin Micropipeta de volumen variable entre 0.5-10 µL

Materiales: a. Puntas con filtro, estériles, libres de RNasa y DNasa, con capacidad de 0.5-10 µL b. Puntas con filtro, estériles, libres de RNasa y DNasa, con capacidad de 2-20 µL

68

c. Puntas con filtro, estériles, libres de RNasa y DNasa, con capacidad de 10-100 µL d. Puntas con filtro, estériles, libres de RNasa y DNasa, con capacidad de 20-200 µL e. Puntas con filtro, estériles, libres de RNasa y DNasa, con capacidad de 2001000 µL f. Tubos tipo eppendorf, estériles, libres de RNasa y DNasa con capacidad de 1.7 mL g. Gasas estériles h. Guantes de nitrilo (libres de talco) i. Batas desechables j. Papel aluminio k. Gradillas de unicel para tubos tipo eppendorf l. Estaciones para trabajo en frío para tubos tipo eppendorf m. Placas de polipropileno con 96 pozos claros especiales para PCR en tiempo real con capacidad de 5 -125 µL n. Tiras con 8 tubos especiales para PCR en tiempo real con capacidad de 0.2 mL o. Tiras con 8 tapas ópticas ultra claras especiales para PCR en tiempo real p. Marcadores indelebles de punto fino q. Contenedores y bolsas para desecho de material biológico-infeccioso r. Pinzas Nota: Cada área de trabajo debe contar con material exclusivo.

Reactivos y materiales biológicos a. b. c. d. e. f. g. h. i. j. k. l.

m. n. o. p.

Cepa de referencia DENV-1 Hawái Cepa de referencia DENV-2 Nueva Guinea Cepa de referencia DENV-3 H-87 o PR-6 Cepa de referencia DENV-4 H-241 Estuche para extracción de RNA viral, (QIAamp® Viral RNA Mini Kit) marca QIAGEN, catálogo 52906, o estuche para extracción automatizada (MagNA Pure 2.0 ROCHE) Enzima para amplificación: SuperScript One-Step RT-PCR con Platinum, marca Invitrogen, catálogo 11372-088 o marca BIORAD, catálogo 170-8894. Agua calidad PCR libre de RNasa, marca Roche, catálogo: 033 159 32 001 Iniciador mFU1: 5’ TACAACATGATGGGAAAGCGAGAGAAA AA 3’ Iniciador CFD2: 5’ GTGTCCCAGCCGGCGGTGTCATCAGC 3’ Sonda DEN-1: 5’FAM–TCAGAGACATATCAAAGATTCCAGGGGG-BHQ1 3 Sonda DEN-2: 5’ Texas Red AAGAGACGTGAGCAGGAAGGAAGGGGGAGC-BHQ2 3 Sonda DEN-3: 5’ Cy5-TGAGAGATATTTCCAAGATACCCGGAGGAG-BHQ3 3’ Sonda DEN-4: 5’ HEX-TGGAGGAGATAGACAAGAAGGATGGAGACC-BHQ1 3’ Etanol al 75% Hipoclorito de sodio al 5% Solución para eliminación de DNA, DNaZap, marca Ambion, catálogo 9892G

69

Notas: 1. Las cepas de referencia fueron donadas por el CDC Dengue-Branch, de San Juan, Puerto Rico (se cuenta con carta de donación). 2. Los fluoróforos pueden ser cambiados por otros, siempre y cuando se encuentren en el mismo canal de adquisición. Esto dependerá de la disponibilidad en la síntesis de cada empresa. * Actualmente se está comenzando a gestionar la adquisición de nuevos iniciadores para la implementación de un mejor RT-PCR para dengue (más sensible y rápido) en los LESP basado en la capacitación recibida en noviembre de 2012. Una vez que se cuente con ellos se deberá informar al InDRE de la implementación de los nuevos protocolos para la vigilancia virológica.

Método Preparación del área de trabajo Cada una de las áreas de trabajo debe contar con material, equipo, reactivos y personal. Antes de empezar, el gabinete de bioseguridad o flujo laminar de cada una de las áreas de trabajo (extracción de ARN, preparación de mezcla maestra de reacción y de ARN de muestras problemas) deberá de limpiarse con hipoclorito de sodio al 5%, agua bidestilada y etanol al 75%, siguiendo ese orden. Irradiar por 20 min con luz ultravioleta, antes y después de trabajar. Si se cuenta con soluciones inhibidora de ARN y ADN se recomienda realizar la limpieza con estas soluciones antes y después de trabajar. El material necesario que se use debe estar listo en cada área de trabajo.

Extracción de ácidos nucleicos Principio del método: El estuche de extracción simplifica la extracción de ARN viral a partir de fluidos libres de células mediante un procedimiento rápido de centrifugación en columna. No se requiere utilizar fenol-cloroformo. El ARN se une específicamente a la membrana de silica-gel, por la cual pasan todos los contaminantes. Los inhibidores de PCR como los cationes divalentes y proteínas, son completamente removidos durante los pasos de lavado dejando el ARN puro y listo para ser eluído con la solución de elución. Preparación de reactivos 1) Agregar 310 μL de amortiguador AVE al tubo que contiene 310 μg de acarreador de ARN liofilizado, para obtener una solución de trabajo de 1.0 μg/μL. 2) Disolver perfectamente, realizar alícuotas en volúmenes suficientes para trabajar 5-10 muestras y almacenar a -20 °C. 3) Evitar ciclos de congelación-descongelación más de tres veces. 70

4) Preparar solución AVL, agregando acarreador de ARN en relación de: 0.56 mL de AVL + 5.6 μL de acarreador de ARN por cada muestra a procesar. 5) La solución de lavado AW1, debe ser preparada agregando 125 mL de etanol (96-100%) grado biología molecular y marcar el frasco para indicar que se le agregó etanol. 6) La solución de lavado AW2, debe ser preparada agregando 160 mL de etanol (96-100%) grado biología molecular y marcar el frasco para indicar que se le agregó etanol. Extracción y purificación de ARN (manual QIAGEN) 1) Agregar 560 μL de solución AVL/acarreador de ARN a un tubo tipo eppendorf de 1.5 mL. Se deberá agregar el acarreador de ARN durante cada proceso de extracción, esto asegura que no se pierda la actividad de este reactivo y asegure la máxima obtención de material genético. 2) Agregar 140 μL de suero o plasma y agitar durante 15 seg. 3) Incubar 10 min a temperatura ambiente y centrifugar brevemente a 1500 rpm/30 seg para mantener la tapa del tubo libre de reactivos. 4) Agregar 560 μL de etanol, agitar durante 15 seg y centrifugar brevemente 1500 rpm/30 seg para mantener la tapa del tubo libre de reactivos. 5) Remover del empaque las columnas/tubo colector a utilizar y etiquetarlas. 6) Tomar 630 μL de la solución anterior y agregar cuidadosamente dentro de la columna, centrifugar a 8000 rpm/1 min, a 4 °C. 7) Cambiar la columna a un tubo colector limpio y repetir el paso anterior. 8) Cambiar la columna a un tubo colector limpio y agregar 500 μL de solución de lavado AW1, centrifugar a 8000 rpm/1 min, a 4 °C. 9) Cambiar la columna a un tubo colector limpio y agregar 500 μL de solución de lavado AW2, centrifugar a 14 000 rpm/3 min, a 4 °C. 10) Cambiar la columna a un tubo etiquetado tipo eppendorf de 1.7 mL limpio, estéril, libre de RNasa y DNasa y agregar 60 μL de solución de elución (AVE). Incubar a temperatura ambiente durante 1 min y centrifugar a 8000 rpm/1 min, a 4 °C. 11) Descartar la columna, cerrar el tubo tipo eppendorf que contiene el ARN de interés. 12) Almacenar a -20 °C si se lleva a cabo la amplificación dentro de las primeras 48 horas, de no ser así se almacena a -70 °C, hasta su uso. Notas: 1. Todos los desechos de los tubos colectores se deben descartar en un recipiente exclusivo para su posterior eliminación.

71

2. Las soluciones de extracción AVL y AW1 contienen sales de guanidina, las cuales pueden formar compuestos altamente reactivos cuando se combinan con cloro. 3. En caso de incorporar un control interno, este deberá adicionarse junto con el acarreador a la solución AVL. El control interno debe tener al menos 200 nucleótidos, moléculas más pequeñas no promueven un buen rendimiento de ARN.

Extracción y purificación de ARN (automatizado MagNA Pure LC 2.0 ROCHE) El método de PCR tiene la facultad de producir una gran cantidad de copias de ADN (Ácido desoxirribonucleico) de doble cadena y en conjunto con la Reacción de Retro-transcripción (RT) es posible obtener moléculas de ADN complementario, a partir de una muestra de ARN. El ARN extraído de las muestras de suero, plasma o fluidos libres de células, es convertido en cADN y posteriormente amplificado para obtener una gran cantidad de copias. El método de extracción automatizada por perlas magnéticas, simplifica la extracción de ARN viral a partir de fluidos libres de células. No se requiere utilizar fenol-cloroformo. El ARN se une específicamente a la superficie de silica de las perlas magnéticas, mientras que todos los contaminantes son removidos durante los pasos de lavado. Enseguida, el ARN es separado de las perlas magnéticas utilizando altas temperaturas, con lo que queda completamente purificado en la solución de elución. Posteriormente, a través del método de RT-PCR, se puede detectar la presencia de altas o bajas concentraciones de ARN, extraído a partir de la muestra primaria.

Preparación de las muestras Se hará en la cabina de bioseguridad tipo 2 del área de extracción de ácidos nucleicos. 1) Anotar la ubicación de las muestras en el formato de trabajo así como todos los datos solicitados en el mismo. 2) Etiquetar los tubos tipo eppendorf de 1.7 mL necesarios dependiendo del número de muestras a procesar. 3) Agregar 200 μL de solución de lisis a cada uno de los tubos tipo eppendorf. 4) Agregar 200 μL de suero o plasma agitar durante 10 segundos. 5) Centrifugar brevemente 1500 rpm/20 seg para mantener la tapa del tubo libre de reactivos. 6) Tomar 350 μL de la solución anterior y agregar cuidadosamente dentro del cartucho para muestras que ingresará al robot de extracción. 7) Tapar el cartucho para muestras con el sello adhesivo y almacenarlo a 4 °C hasta su ingreso al robot de extracción.

72

Preparación del anaquel de reactivos Se hará en la mesa de trabajo del área de extracción de ácidos nucleicos. 1) Colocar los recipientes en el anaquel de reactivos. 2) Agregar en su respectivo recipiente (para procesar 32 muestras): 32 mL de solución de lavado 1 (tapa negra); 33 mL de solución de lavado 3 (tapa roja); 16.5 mL de solución de lavado 2 (tapa azul); 7.0 mL de solución de elución (tapa amarilla); 5.0 mL de proteinasa K (tapa rosa) previamente diluida con 5.0 mL de solución de elusión; y 6.0 mL perlas magnéticas (tapa café). Finalmente, colocar las tapas de los recipientes. Preparación del robot e inicio de la extracción 1) Asignar un número o nombre de corrida y registrarlo en la base de datos electrónica del robot. 2) Colocar los insumos, el anaquel de reactivos y las muestras en el robot. 3) Verificar que tanto el volumen del contenedor de líquidos como el contenido de la bolsa de desechos de puntas, no rebasen tres cuartas partes de su capacidad. 4) Iniciar la corrida del robot

73

Obtención del ARN purificado 1) Marcar con la clave asignada los tubos tipo eppendorf en los cuales serán envasados los extractos de ARN. 2) Al terminar la corrida, tapar con el sello adhesivo el cartucho donde se colectaron los extractos. Envasar los extractos en la campana de bioseguridad. Registrarse en la bitácora de la campana de bioseguridad. 3) Almacenar a -20 °C si se lleva a cabo la amplificación dentro de las primeras 48 horas, de no ser así se almacena a -70 °C, hasta su uso. 4) Retirar del robot los insumos utilizados y desecharlos en la bolsa roja. 5) Con una gasa humedecida con etanol al 75%, limpiar la superficie interna del robot y la resbaladilla de desecho de puntas. 6) Descontaminar el robot por 30 min. Después de este tiempo apagar el equipo. Notas: 1. El robot procesa las muestras en 4 filas para 8 muestras cada una. El software del equipo calcula automáticamente la cantidad de reactivos e insumos (cartuchos, puntas) necesarios para procesar diferentes cantidades de muestras. 2. Todo el volumen de la proteinasa K reconstituida se utiliza para la extracción de 32 muestras, en caso de extraer un número menor de muestras, tomar el volumen necesario de acuerdo con el número de muestras, y el resto de la proteinasa K almacenarla a -20 °C, hasta su utilización. 3. En caso de incorporar un control interno, este deberá adicionarse junto con el acarreador a la solución AVL. El control interno debe tener al menos 200 nucleótidos, moléculas más pequeñas no promueven un buen rendimiento de ARN. 4. En caso de que se requiera realizar la extracción de menos de 24 muestras, se deberá seguir el método de extracción manual de ácidos nucleicos.

Amplificación del ARN Cálculo de reactivos y ubicación de muestras Con base en el número de muestras y controles (positivos y negativos) se realizan los cálculos correspondientes para preparar la mezcla maestra de reacción, estos datos se deben anotar en la hoja de trabajo correspondiente. La persona encargada de realizar la mezcla maestra de reacción, determinará el número requerido de tubos/pozos, de acuerdo con el número de muestras problema y controles. 1) Realizar los cálculos de cada uno de los reactivos, de acuerdo con el número de muestras y controles. Considerar un excedente suficiente. 2) Anotar la ubicación de las muestras y controles en la hoja de trabajo así como todos los datos solicitados en la misma. 3) Abrir el programa del termociclador para crear un nuevo documento (placa) basándose en el formato existente (“Plantilla Dengue”) para ubicar en la misma posición las muestras y controles en la placa del programa como en la hoja de trabajo. 74

4) Guardar el documento elaborado con la fecha (DD/MM/AA) en la carpeta correspondiente. 5) El uso de la plataforma de BIORAD CFX96 no es exclusivo, la estandarización de este método también se realiza en la plataforma de Applied Biosystem 7500 Fast, obteniéndose los mismos resultados. El uso de otra plataforma requerirá ser evaluado. Preparación de mezcla maestra de reacción 1) Descontaminar el gabinete con solución marca ZAP para eliminar RNasa y DNasa. 2) Sacar del congelador los reactivos a utilizar, manteniéndolos siempre en frío. 3) Trabajar siguiendo las buenas prácticas de laboratorio para biología molecular. 4) Agregar cada uno de los reactivos que conforman la mezcla maestra de reacción con base en la hoja de trabajo realizada. 5) Agregar 20 µL de la mezcla maestra de reacción a cada tubo/pozo a utilizar. 6) Agregar 5.0 µL de agua calidad biología molecular al tubo/pozo que contendrá el control negativo de reactivo y taparlo. 7) Pasar al área de adición de los ARN de muestras problema, los tubos/pozos que contienen la mezcla maestra de reacción evitando exponerlos al ambiente, para ello se deben trasladar en una caja limpia cerrada y libre de RNasas y DNasas. Adición de los ARN de muestras problemas 1) Descontaminar el gabinete con solución marca ZAP para eliminar RNasa y DNasa. 2) Limpiar el área, sacar los ARN de las muestras problema del congelador, manteniéndolos en frío. 3) Trabajar siguiendo las buenas prácticas de laboratorio para biología molecular. 4) Agregar 5.0 µL del ARN de la muestra problema a cada tubo/pozo siguiendo la ubicación de la hoja de trabajo correspondiente. Al terminar de colocar una hilera esta deberá de taparse usando tiras de tapas. Evitar el contacto directo de los guantes al momento de tapar. 5) Ingresar los tubos/pozos al termociclador, seleccionar en el programa el protocolo de amplificación e iniciar la corrida. Interpretación de las curvas de amplificación a. Los valores de amplificación se expresan en valores de Cq. Donde un Cq es el ciclo a partir del cual los valores de fluorescencia relativa rebasan el punto de corte o umbral. El Cq es inversamente proporcional a la cantidad de ARN presente en la muestra.

75

b. Cada una de las curvas de amplificación tiene asignado un color para diferenciar entre los cuatro serotipos, como se indica a continuación: Color verde (fluoróforo FAM) para identificar DENV-1 Color rojo (fluoróforo Rojo Texas) para identificar DENV-2 Color azul (fluoróforo Cy5) para identificar DENV-3 Color negro (fluoróforo HEX) para identificar DENV-4 c. Para que la muestra sea considerada positiva deberá presentar claramente curvas sigmoides bien definidas. d. Muestras con valor de Cq menor o igual a 35 son positivas. e. Muestras con valor de Cq mayor o igual a 39 son negativas. f. Muestras con Cq menores a 35, pero con curvas NO sigmoides, no deben reportarse y deben repetirse por duplicado. g. Muestras con valor de Cq entre 36 y 38 repetir por duplicado. Si se obtiene nuevamente el mismo resultado se debe repetir el ensayo desde la extracción de ARN, también se recomienda realizar una dilución del ARN (1:5 o 1:10 a consideración del analista); en este caso se amplificarán nuevamente la primera extracción de ARN, la nueva extracción y en su caso la dilución. En caso de obtener el mismo resultado se reporta como positivo, haciendo la aclaración que presenta ciclos altos (positivo bajo). h. Muestras con más de un serotipo identificado, se deben repetir desde la extracción de ARN. Esto para descartar posible contaminación. Si se obtiene el mismo resultado se deben enviar al InDRE para control de calidad. Notas: 1. En caso de incorporar un control interno se deben seguir las instrucciones de uso del fabricante. 2. Los controles positivos y negativos sirven para monitorear alguna falla en alguno de los reactivos del ensayo y para validar el ensayo. 3. El ensayo se debe repetir si alguno de los controles positivos no amplifica o si estuvieran fuera del rango esperado o si el control negativo amplificara.

Durante los procesos antes mencionados se deberán seguir las siguientes prácticas de laboratorio: 1. Manejo adecuado de reactivos. Asegurarse que los reactivos se usen y manejen siguiendo las buenas prácticas de laboratorio para biología molecular. Mantenerlos en red fría durante su uso. Evitar ciclos de congelamiento y descongelamiento prolongados. 2. Manejo adecuado del equipo. Usar adecuadamente el equipo siguiendo las instrucciones de uso descritas en los manuales de operación del mismo. 3. Áreas de trabajo. Se debe contar con áreas separadas para extracción, preparación de mezcla maestra de reacción, adición de los ARN problema y adición de controles positivos. Al finalizar el trabajo en cada área se deberá descontaminar el área de trabajo. Se sacará y desechará todo el material sucio, de no hacerlo se puede provocar contaminación. 4. Personal. Contar con personal capacitado para el adecuado desarrollo del método e interpretación de resultados.

76

5. Evitar la contaminación del área con ADN de las reacciones realizadas, por lo que se recomienda desechar las placas/tubos en el contenedor de biológicoinfeccioso en otra área diferente. Si se requiere almacenar el ADN para realizar análisis posterior a la amplificación se recomienda hacerlo en otra área independiente. Interpretación de resultados Negativo: No existe presencia de ARN viral o existe carga viral extremadamente baja relacionada con la sensibilidad del método. Se confirma infección por dengue (por tener resultado NS1 positivo) Positivo: Es indicativo de infección reciente y presencia de ARN viral del (de los) serotipo (s) detectado (s). La RT-PCR Multiplex en tiempo real determina la presencia de ARN de los cuatro serotipos del virus dengue en suero y plasma. Un resultado positivo es indicativo de infección reciente provocada por el serotipo o serotipos identificados. Medidas de bioseguridad Toda muestra recibida en el laboratorio se considera potencialmente infecciosa. Los mecanismos de contención dependen del agente infeccioso, en el caso de extracción de material genético y amplificación se requiere de áreas exclusivas, con gabinetes de bioseguridad nivel 2 para extracción y preparación de reactivos e incorporación de los ARN de muestras problema, se requieren gabinetes con especificaciones para trabajar reacciones de PCR. Cada gabinete deberá estar ubicado en áreas delimitadas y separadas. El manejo de virus en biología molecular requiere personal altamente capacitado y protección específica para el analista. El personal emplea guantes libres de talco y batas desechables. Para sanitizar las áreas y superficies de trabajo, es necesario utilizar hipoclorito de sodio al 7.5%, agua bidestilada y etanol al 75% (siempre utilizar en ese orden para no promover vapores que se forman con el contacto de hipoclorito y etanol) o en su caso usar las soluciones correspondientes para eliminación de RNasas y DNasas .

77

Cuadro 2. Relación de solución AVL, RNA-AVE por muestra

78

140 µL de muestra + 560 µL de buffer AVL- acarreador RNA

Lisis de Muestra

Incubar 10 min a temperatura ambiente

Agregar 560 µL de etanol a la mezcla anterior y tomar 630 µL y centrifugar 8000 rpm/1 min, a 4 °C Agregar nuevamente 630 µL de la mezcla anterior y centrifugar 8000 rpm/1 min, a 4 °C

Agregar 500 µL de Buffer AW1 y centrifugar a 8000 rpm/1 min, a 4 °C

Agregar 500 µL de Buffer AW2 y centrifugar a 14 000 rpm/3 min, a 4 °C

Agregar 60 µL de buffer de elución y centrifugar 8000 rpm/1 min, a 4 °C

Figura. 4. Guía rápida de extracción manual de ácidos nucleicos (QIAGEN)

79

*La extracción de ARN mediante el uso de ROBOT MagNA Pure 2.0 de la marca ROCHE deberá realizarse siguiendo las indicaciones de la compañía fabricante y deberá ser usado para la extracción de lotes mayores a 24 muestras, con el objetivo de minimizar la contaminación.

Figura. 5. Diseño de placa para ubicación de controles y muestras Los controles positivos y negativos deberán estar separados de las muestras problemas con un diseño de adición de muestras de izquierda a derecha, promoviendo tapar cada columna una vez que se haya terminado de adicionar las muestras.

80

Figura. 6. Protocolo de amplificación de ensayo; temperaturas, tiempo, número de ciclos y colección de datos

Figura. 7. Tiempo de corrida para detección y serotipificación de los cuatro serotipo de virus dengue por RT- PCR Multiplex en tiempo real (3:58 horas)

Figura. 8. Resultados de amplificación

81

Gráficas de amplificación presentadas en formato logarítmico. En color verde se observan las muestras identificadas para serotipo DENV-1; en rojo para serotipo DENV-2; en azul para serotipo DENV-3 y en negro para serotipo DENV-4. II. CARACTERÍSTICAS DE LOS ESTUCHES COMERCIALES Tipo de prueba

Formato

Dengue IgM

ELISA

Dengue IgG

ELISA

Dengue NS1 Platelia SD Dengue captura de antígeno NS1 UMELISA Dengue plus SD Dengue IgG captura Dengue IgG/IgM Lafon Hexagon Dengue IgG/IgM Nova Test Dengue IgM/IgG Dengue NS1 Ag strip Simplexa Dengue Kit SD BIOLINE DENGUE DUO (NS1 + IgM + IgG)

Fabricante Inverness Medical Innovations Inverness Medical Innovations

Sensibilidad %

Especificidad %

93.6

100

94.5

97.3

ELISA

BIORAD, Francia

93.7 (84.9-97.0)

100 (92.9-100)

ELISA

Standard Diagnostics, Corea

84 (74.5-90.4)

100 (92.9-100)

TECNOSUMA, Cuba Standard Diagnostics, Corea

91.7 (80.4-96.7) 84.6 (72.5-92.0)

Prueba rápida inmunocromatográfica

Standard Diagnostics, Corea

71.4 (63.7-78.1)

86 (73.8-93.0)

Prueba rápida inmunocromatográfica

Human Geselischaft für Biochemica and Diagnostica mbH, Alemania

45.95 (35.1-57.2)

100 (92.9-100)

Prueba rápida inmunocromatográfica

Atlas Link, Beijing China

43.1 (31.2-55.9)

70 (56.2-80.9)

ELISA ELISA

Prueba rápida inmunocromatográfica RT-PCR en tiempo real Prueba rápida inmunocromatográfica

BIORAD, Francia Focus Diagnostics, California Standard Diagnostics, Korea

Los resultados están por salir Los resultados están por salir NS1=90.91 IgM=68.29 IgG=92.31 *Sensibilidad global=92.63

100 (92.9-100) 98 (89.3-99.6)

NS1=98.86 IgM=100 IgG=99.22 *Sensibilidad global=100

La sensibilidad global de SD BIOLINE DENGUE DUO (NS1+IgM+IgG) refiere la concordancia para identificar en una muestra la presencia o ausencia de al menos uno de los tres marcadores analizados en una muestra. Esta evaluación fue realizada únicamente en muestras en fase aguda de la enfermedad, por tal motivo deberá ser utilizada bajo estas condiciones y con la matriz de muestra de suero. *Cualquier tipo de prueba comercial que NO cumpla con los estándares de laboratorio para la vigilancia de dengue y que NO haya sido avalada por el InDRE mediante los resultados de una evaluación NO deberá ser

82

utilizada por emergencia.

ninguna

razón

ni

bajo ninguna

circunstancia

de

Estas evaluaciones son válidas mientras el reactivo no sufra modificaciones en sus componentes. La sensibilidad para las pruebas de diagnóstico (formato de ELISA) es de 93-100% y la especificidad de 96-100%. Los datos de sensibilidad y especificidad obtenidos en las evaluaciones que se realicen a las marcas comerciales serán informados a la RNLSP, el informe final de la evaluación es propiedad del proveedor y/o fabricante.

83

III. FORMATO PARA ENVÍO DE MATERIAL BIOLÓGICO AL InDRE Número en plataforma (seis ultimos digitos)

Nombre

Edad M

134597 134748 142856 143546 153746 163689 174590

Anabel Carrillo Dorante Gerardo Roman Rosas Fernando Meza Arredondo Dalia Maria Maldonado Rojas Jacinto Corella Linares Rosendo Miranda Morales Mariana Castillo Ruiz

Fecha inicio

Fecha toma

F 4

45 62 12 23 52 35

Caso probable FD o FHD

17/01/2012 24/01/2012 15/02/2012 04/03/2012 23/03/2012 08/04/2012 20/04/2012

21/01/2012 31/01/2012 18/02/2012 05/03/2012 29/03/2012 12/04/2012 20/04/2012

FD FD FD FD FD FD FD

84

Diagnóstico NS1 Resultado NEGATIVO

Valor 0.06

NEGATIVO POSITIVO

0.03 12.78

NEGATIVO POSITIVO

0.23 7.35

RT-PCR Serotipo Valor de ct

DEN-1

IgM Resultado Valor POSITIVO 34.65 NEGATIVO 6.45

NEGATIVO NEGATIVO

11.14 14.59

POSITIVO NEGATIVO

23.46 6.51

18.13 NEGATIVO NEGATIVO

DEN-2

IgG Resultado Valor

26.34

2.16 1.37

Loading...

lineamientos para la vigilancia epidemiológica de dengue - gob.mx

Dirección General de Epidemiología lineamientos para la vigilancia epidemiológica de dengue por laboratorio Instituto de Diagnóstico y referencia Ep...

4MB Sizes 5 Downloads 12 Views

Recommend Documents

Lineamientos para la Vigilancia por Laboratorio de Enfermedad de
Preparar y enviar paneles de eficiencia (PEED SEROCHAGAS) a los LESP participantes. • Capacitar .... se envía de inme

protocolo para la vigilancia en salud pública del dengue
1.2 OBJETIVOS ESPECÍFICOS. 2. ... OBJETIVOS. 1.1. OBJETIVO GENERAL. Realizar el seguimiento continuo y sistemático de

Vigilancia de la Resistencia a
Dec 1, 2010 - Enterobacter spp. Haemophilus influenzae. Campylobacter spp. Neiseria gonorrhoeae. Streptococcus β hemolÃ

Vigilancia de la Resistencia a
lizar estudios complementarios y aclarar toda duda que surja de las actividades que realizan los participantes nacionale

C. Lineamientos estratégicos para la formulación de políticas y
educativas. Se incentivará la innovación pedagógica y el uso de nuevas TIC para la formación de competencias laborales y

Manual de vigilancia STEPS de la OMS
Jan 3, 2016 - SECCIÓN 3: MODELOS PARA LA PRESENTACIÓN DE RESULTADOS (HOJA DE DATOS Y MANUAL DE ...... enviar cartas de

Lineamientos de Inocuidad de los Alimentos Específicos para - FDA
alimentos conforme a las normas, estándares y lineamientos vigentes. Esta información se brinda de buena fe y es ....

Nuevos Lineamientos para Publicar en la REMO - Revista Mexicana
Directorio: Director: Dr. Héctor Magaña Vargas ([email protected]). Editora en Jefe: Dra. Guadalupe Escamilla Gil ([email protected]

Lineamientos para comunicar información sobre la - dipecho lac
http://ec.europa.eu/echo/files/aid/countries/factsheets/thematic/EU_building_resilience_en.pdf. Los proyectos .... Varia

plan de acción para la vigilancia y aplicación de medidas de - gob.mx
Feb 18, 2015 - monitoreo de estas para una detección oportuna y en consecuencia mitigar el riesgo de introducción al p